Fused type prokaryotic expression vector and construction method and application thereof

A prokaryotic expression and fusion technology, applied in the field of expression vectors and fusion prokaryotic expression vectors

Active Publication Date: 2015-05-20
CUSABIO TECH LLC
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no literature report that fusing the difficult-to-express target protein gene downstream of the β2 microglobulin gene can improve the expression efficiency of the target protein in the prokaryotic system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fused type prokaryotic expression vector and construction method and application thereof
  • Fused type prokaryotic expression vector and construction method and application thereof
  • Fused type prokaryotic expression vector and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1 Contains the construction of the expression vector pET-β2M of β2M gene

[0025] 1) Synthesize the following nucleotide sequences with His purification tag, β2 microglobulin, enterokinase cleavage site, and polyclonal cleavage site:

[0026] CATCATCATCATCATCAT ATCCAGCGTACTCCAAAGATTCAGGTTTACTCACGTCATCCAGCAGAGAATGGAAAGTCAAATTTCCTGAATTGCTATGTGTCTGGGTTTCATCCATCCGACATTGAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTTGTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACTGAAAAAGATGAGTATGCCTGCCGTGTGAACCATGTGACTTTGTCACAGCCCAAGATAGTTAAGTGGGATCGAGACATG GACGACGACGAC AAG GGATCCGAGCTCCGTCGACAAGCTTGCGGCCGC (SEQ ID No. 2)

[0027] 2) In primer 1: 5'GTAC CCATGG GCCATCATCATCATCATCATAT3' (the underlined part is the Nco I recognition site)

[0028] Primer 2: 5'GTAC GCGGCCGC Under the guidance of AAGCTTGTCGACGGAGCTCG3' (the underlined part is the Not I recognition site), PCR was performed using the sequence in step 1) as a template, and the following nucleot...

Embodiment 2

[0031] Example 2 Construction of the expression vector pET-β2M-Vpr containing the Vpr protein gene of HIV and the β2M gene

[0032] 1) Synthesize the following Vpr gene sequence

[0033]ATGGAACAAGCCCCAGAAGACCAAGGGCCACAGAGGGAGCCACACAATGAATGGACACTAGAGCTTTTAGAGGAGCTTAAGAATGAAGCTGTTAGACATTTTCCTAGGATTTGGCTCCATGGCTTAGGGCAACATATCTATGAAACTTATGGGGATACTTGGGCAGGAGTGGAAGCCATAATAAGAATTCTGCAACAACTGCTGTTTATCCATTTCAGAATTGGGTGTCGACATAGCAGAATAGGCGTTACTCAACAGAGGAGAGCAAGAAATGGAGCCAGTAGATCC(SEQ ID No.3)

[0034] 2) Primer 1: 5'GTAC GGATCC ATGGAACAAGCCCCAGAAGA3' (the underlined part is BamH I recognition site)

[0035] Primer 2: 5'GTAC GCGGCCGC TTAGGATCTACTGGCTCCATTTC (the underlined part is Not I recognition site 1) was used as a guide, and the gene in step 1) was used as a template to perform PCR to obtain the following Vpr gene with Bam H I and Not I recognition sites:

[0036] GTAC GGATCC ATGGAACAAGCCCCAGAAGACCAAGGGCCACAGAGGGAGCCACACAATGAATGGACACTAGAGCTTTTAGAGGAGCTTAAGAATGAAGCTGTTAGACATT...

Embodiment 3

[0038] Expression and separation and purification of the Vpr protein of embodiment 3HIV

[0039] 1) The expression plasmid pET-β2M-Vpr obtained in Example 2 was treated with CaCl 2 Escherichia coli BL21 was transformed by method, and LB solid medium containing 100ug / ml kanamycin was used for selection. The Vpr expression strain was obtained and named pET-β2M-Vpr / BL21.

[0040] 2) Pick a single colony and culture it with LB liquid medium containing 100ug / ml kanamycin at 37°C and 220rpm for about 16 hours, then transfer 1% to fresh LB containing 100ug / ml kanamycin The liquid medium was shaken at 37°C and 220rpm for about 3 hours until OD600≈0.6, and IPTG was added to a final concentration of 1mM, and the shaking was continued for 3 hours.

[0041] 3) Centrifuge at 10,000 rpm at 4°C for 10 minutes to collect bacteria. Resuspend the bacteria in PBS, collect the bacteria by centrifugation for 10 minutes, resuspend the bacteria with 20mM pH8.0 Tris-HCl, 5mM EDTA, and sonicate the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a fused type prokaryotic expression vector, and a construction method and application thereof. The fused type prokaryotic expression vector comprises a promoter, a purification tag gene, a protease cleavage site, a multiple cloning site and a terminator, wherein a Beta 2 microglobulin gene is connected between the purification tag gene and the protease cleavage site. According to the fused type prokaryotic expression vector, the Beta 2 microglobulin (Beta 2M) gene is contained in the fused type prokaryotic expression vector, a foreign protein which is hard to express is connected to the downstream of the Beta 2M gene, thus the excellent characteristics of the Beta 2M gene expression vector can be fully utilized while the expression carrier expresses the foreign protein which is hard to express, the foreign protein can be effectively expressed in a host cell, and the target protein can be conveniently renatured and separated and purified in the later period; in addition, a purification tag and an enzyme cleavage site are contained in the fused type prokaryotic expression vector, thus the protein can be conveniently separated and purified after the expression, and the purification tag and the Beta 2M protein also can be conveniently removed, and as a result, the target protein closer to the natural sequence can be gained.

Description

technical field [0001] The present invention relates to an expression vector, in particular to a fusion type prokaryotic expression vector and its construction method. The present invention further relates to the application of the fusion type prokaryotic expression vector in expressing foreign proteins, belonging to the field of fusion type prokaryotic expression vectors. Background technique [0002] Since human immunodeficiency virus (HIV-1) was first isolated in 1983 from a patient with generalized lymphadenopathy, tremendous progress has been made in understanding the viral life cycle and the functional significance of the nine genes encoded by HIV-1. improvement. Much attention has been paid to the four open reading frames Vif, Vpr, Vpu and Nef of HIV-1. These genes were originally called accessory genes. These gene products jointly regulate host cell physiology to facilitate viral replication. They play a large role in the pathogenic mechanism of HIV-1, especially th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/70C12N15/74C12N15/75
Inventor华权高马峰沈鹤霄舒芹易汪雪
OwnerCUSABIO TECH LLC