Method for synthesizing short single strand deoxyribonucleotide probe

A deoxyribonucleotide, single-stranded technology, which is used in the field of synthesizing short single-stranded deoxyribonucleotide probes, can solve the problem of primer mutations, inability to use single-stranded probes for experiment and diagnosis, and no long single-stranded cleavage. Problems such as forming specific short chains

Active Publication Date: 2013-09-04
深圳弸福科技有限公司
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

PCR (polymerase chain reaction, polymerase chain reaction) is used to produce short nucleotide probes with a length of 30 bases (Bertilsson et al., 2002, Appl Environ Microbiol), but this method has two disadvantages : One is that PCR needs to amplify with chemically synthesized primers, and the synthetic primers always have mutations, which makes the PCR products carry the mutations in the primers, causing the products to be less than 100% pure, and to The length of the amplified product is limited; another disadvantage is that the product synthesized by PCR is double-stranded, and additional steps are required to separate the double-stranded and purify the target single-stranded
This method has great limitations: constant temperature amplification has strict requirements on the length of the amplified oligonucleotide, if the oligonucleotide to be amplified is too long, the Tm value will be too high, and the incision will end The oligonucleotide fragment produced after the enzyme acts on the double-stranded oligonucleotide fragment will not fall off from the template; on the contrary, if the oligonucleotide to be amplified is too short, the Tm value will be too low, and the oligonucleotide Acid fragments are easily detached from the template
The disadvantages of this method: one is that the errors in the chemically synthesized template and primers are brought into the product; the other is that there is no way to cut the long single strand into specific short strands; Dicerase cuts, but requires the target DNA fragment to be replicated and amplified to contain a restriction site, that is, it cannot amplify a specific sequence without endonuclease, and the cut product is still double-stranded, which cannot be used for single-strand detection. Needle experiments and diagnostics

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthesizing short single strand deoxyribonucleotide probe
  • Method for synthesizing short single strand deoxyribonucleotide probe
  • Method for synthesizing short single strand deoxyribonucleotide probe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment one: preparation microRNA probe method one

[0042] Step 1: Design the DNA sequence to be amplified. The 5' end is a sequence that can form a neck loop structure containing a type II endonuclease BtsCI site, and the 3' end is an antisense sequence (probe) of a microRNA , or for any sequence of DNA, see figure 1 a. In order to optimize production and follow-up experiments, the above-mentioned neck loop-microRNA probe sequence is superimposed to form a neck loop-probe-neck loop-probe-neck loop sequence, and Nt.BstNBI is added to the 5' end of this sequence The nickase recognition site GAGTGatat, and finally an EcoRI endonuclease recognition site GAATTC is added at both ends, such as figure 1 b.

[0043] The sequence of the mouse microRNA mmu-miR-124-3p (sequence number MIMAT0000134) to be detected is 5'UAAGGCACGCGGUGAAUGCC3' (seq No.3). The sequences designed for the production of miR-124 probes are shown in Table 1.

[0044] Table 1 is used to produce the...

Embodiment 2

[0055] Embodiment two: prepare microRNA probe method two

[0056] Method 2 is roughly the same as method 1, except that in the sixth step of method 1, 0.1mM DIG-dUTP and 0.1mM dTTP are used instead of 0.2mM dTTP, so that the single-stranded DNA synthesized by phi29 DNA polymerase is incorporated into DIG-dUTP . DIG is a marker, which can be digoxin, fluorescein, biotin, isotope, etc. After completing the ninth step of tapping and purifying the DNA, the labeled DNA probes are obtained.

Embodiment 3

[0057] Example 3: Detection of mouse miR-124 with the made target single-stranded DNA probe (i.e. miR-124 probe)

[0058] first step:

[0059] Eight micron thick slices of embryonic day 12.5 mouse brain processed as follows

[0060] 1. Xylene dewaxing twice, 15 minutes each time

[0061] 2. Wash twice with 100% ethanol, 5 minutes each time

[0062] 3. Wash with 70% ethanol for 5 minutes

[0063] 4. Wash with 30% ethanol for 5 minutes

[0064] 5. Wash in deionized water for 5 minutes

[0065] 6. Wash twice in 1x PBS, 5 minutes each

[0066] 7.4% PFA fixed on ice for 20 minutes

[0067] 8. Wash twice in 1xPBS, 5 minutes each

[0068] 9. 10 μg / ml proteinase K in 1x proteinase K buffer for 5 min

[0069] 10. Wash twice in 1xPBS, 2 minutes each time

[0070] 11.4% PFA fixed on ice for 10 minutes

[0071] 12. Wash twice in 1xPBS, 5 minutes each

[0072] 13. Treat in 1xTEA [200ml of0,1M triethanolamine-HCl, pH8] containing 600μl acetic anhydride for 10 minutes

[0073] 14...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of DNA (deoxyribonucleic acid) biosynthesis, and in particular relates to a method for synthesizing a short single strand deoxyribonucleotide probe and application thereof. The short single strand deoxyribonucleotide probe can be used for detecting small non-coding ribonucleic acid (RNA) such as micro ribonucleic acid. The method comprises the following steps of: (1) preparing plasmids recombined with template DNA; (2) cutting and connecting the template DNA, performing enzyme digestion on the recombined plasmids to obtain the template DNA, and connecting the template DNA end to end to form a ring; (3) cutting a single strand, performing rolling-circle replication, cutting one strand of the template DNA by using nickase, adding polymerase to perform rolling-circle replication by taking annular DNA with a nick as a template, and amplifying to obtain a DNA single strand containing a neck ring-probe structure; and (4) preparing target short single strand DNA, cutting the product of the step (3) by using a type II incision enzyme to form a target single strand DNA probe and a byproduct DNA, and separating and purifying through PAGE (polyacylamide gel electrophoresis) to obtain a single strand DNA probe without mutation. The short single strand deoxyribonucleotide probe has wide applications in the fields of detection of small non-coding RNA and diagnosis and treatment of small non-coding RNA related diseases.

Description

technical field [0001] The invention belongs to the field of DNA biosynthesis, in particular to a method for synthesizing a short single strand deoxyribonucleotide (short single strand DNA, sssDNA) probe, which can be used to detect small non-coding ribonucleic acid (small non-coding RNAs) , such as microRNA (microRNA). Background technique [0002] Short single-strand deoxyribonucleotides (sssDNA) can be used as probes for scientific research and medical diagnosis. In the past decade or so, the research on small non-coding RNAs, especially microRNAs, has been very hot. Scientists and pharmaceutical companies are also very optimistic about the prospect of using microRNAs as targets to develop diagnostic kits and drugs. Since microRNAs usually have only 18-30 bases (Bartel, 2004), and the difference between a family of microRNAs may be only 1-2 bases (www.mirbase.com), if you use the hybridization method to detect microRNAs, The purity requirements for probes are high. If ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11C12N15/10
Inventor彭长庚温婷
Owner深圳弸福科技有限公司