Unlock instant, AI-driven research and patent intelligence for your innovation.

Lentivirus vector, preparation and application of and virus particle thereof

A technology of lentiviral vectors and lentiviral particles, which is applied in the field of preparation and application of lentiviral vectors and their viral particles, can solve the problems of unstable recombination efficiency, difficulty in large-scale production, expensive enzymes, etc., to shorten the experimental cycle, The effect of saving reagent cost and high virus titer

Inactive Publication Date: 2013-09-11
上海诺百生物科技有限公司
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When constructing expression vectors, this system requires two recombinases—BP recombinase and LR recombinase. These two enzymes are expensive and sensitive to temperature, so the recombination efficiency is often unstable.
[0004] Although the lentiviral system of Clontech Company is relatively simple in vector construction, the transfection reagent developed by the company is used in the packaging process, which is expensive and difficult for large-scale production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lentivirus vector, preparation and application of and virus particle thereof
  • Lentivirus vector, preparation and application of and virus particle thereof
  • Lentivirus vector, preparation and application of and virus particle thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 carrier backbone

[0037] The schematic diagram of lentiviral vector construction is shown in figure 2 .

[0038] Construction of lentiviral vector: Plasmid pLenti6.3 / V5-DEST (purchased from Invitrogen, see figure 1 ) was double digested with BamHI and XhoI to recover the backbone part of the vector.

Embodiment 2

[0039] Example 2 Insertion of multiple cloning site fragments

[0040] Design and synthesize 2 oligonucleotide chains with the following sequences:

[0041] Forward: (5'→3')

[0042] GATCCAGTGTTAATTAAGGAAGCTAGCAATAGGCGCGCCTTGGATTTAAATGGCTGTTTAAACTTATC (SEQ ID NO. 1);

[0043] Reverse: (5'→3')

[0044] TCGAGATAAGTTTAAACAGCCATTTAAATCCAAGGCGCGCCTATTGCTAGCTTCCTTAATTAACACTG (SEQ ID NO. 2).

[0045]The two oligonucleotide strands were annealed, ligated with the backbone of the vector in Example 1 with T4 DNA ligase, transformed into E. coli, positive plasmids were selected, the plasmids were amplified and verified by sequencing. The verified correct vector was digested with XhoI, and the fragment was recovered.

Embodiment 3

[0046] Example 3 Re-inserting IRES-GFP fragment to obtain lentiviral vector of the present invention

[0047] Design primers with reference to the pIRES-GFP vector sequence, and add XhoI sites at both ends. The designed primer sequences are as follows:

[0048] Upstream primer:

[0049] 5'-TTTATTCTCGAGGCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGA-3' (SEQ ID NO. 4);

[0050] Downstream primers:

[0051] 5'-TTTATTCTCGAGTTACTTGTACAGCTCGTC3-' (SEQ ID NO. 5).

[0052] PCR reaction was carried out using pIRES2-EGFP vector (purchased from Clontech Company Catalog#6029-1) as a template. The amplification program was denaturation at 95°C for 30 seconds, annealing at 50°C for 30 seconds, extension at 72°C for 1 minute, 30 cycles, and a final extension at 72°C for 10 minutes. Thus, an IRES-GFP fragment was obtained.

[0053] The IRES-GFP fragment amplified by PCR was digested with XhoI, purified, and the amplified fragment was connected to the recovered fragment obtained in Example 2. The l...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lentivirus vector, and preparation and application of a virus particle thereof. The lentivirus vector takes lentivirus vector pLenti6.3 / V5-DEST as a framework, the fragment between BamHI and XhoI enzyme digestion sites is replaced by a multiple cloning site fragment, and an IRES-GFP fragment is inserted to the 3' end of the multiple cloning site fragment in a transcription direction. Sequentially, the multiple cloning sites are: BamHI, PacI, NheI, AscI, SwaI and PmeI. The IRES-GFP fragment adopts a pIRES2-EGFP vector as a template, and is prepared by subjecting upstream and downstream primers to PCR amplification, wherein the nucleotide sequences of the upstream and downstream primers are shown as SEQ ID NO.4 and SEQ ID NO.5. The preparation of the virus particle involved in the invention can be achieved by using cheap chemical reagents, and the prepared virus particle has high titer and good activity, and can reach a very good effect in infection of target cells.

Description

technical field [0001] The invention belongs to the field of biotechnology, and particularly relates to the preparation and application of a lentiviral vector and virus particles thereof. Background technique [0002] Lentivirus vector is a gene transfer vector developed on the basis of HIV-1 (human immunodeficiency virus type I), and has received more and more attention in modern biomedical research. In recent years, it has been applied to some difficult-to-transfect cells, such as primary cells, stem cells, undifferentiated cells, etc., which can greatly improve the transduction efficiency of the target gene, and the probability of integrating the target gene into the host cell genome is greatly increased. [0003] Lentivirus systems The most influential systems currently on the market are those introduced by Invitrogen (recently changed to Life Technologies) and Clontech. Invitrogen's HiPerform system contains one expression plasmid and three packaging plasmids. The expr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867
Inventor 叶军陈海旭
Owner 上海诺百生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com