Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof

A technology of resistance genes and molecular markers, applied in the field of agricultural biology, can solve the problems of misselection or missed selection in resistance breeding, and achieve low-cost and high-specificity effects

Active Publication Date: 2013-09-18
PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI
View PDF0 Cites 41 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these markers are located on the flanks of the resistance gene Pi9, and there is a certain physical distance from the target gene. Therefore, there is a risk of exchange with the target gene during meiosis, and misselection is prone to occur in resistance breeding. or omission

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof
  • Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof
  • Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Rice blast resistance gene Pi9 gene-specific molecular marker and its primer design and detection

[0036] (1) Analysis of Pi9-specific single base difference (SNP) sites:

[0037] The partial genome sequences of the publicly published rice donor varieties Pi9 and Pi2 (Genebank accession numbers: DQ285630 and DQ352453 respectively) and the genome sequences of the corresponding regions of the sequenced variety Nipponbare were downloaded from the public database, targeting the Pi9 locus Sequence comparison was carried out to screen the specific single base (SNP) difference site specific to Pi9 and able to distinguish it from other rice blast allele resistance genes at this site. The multiple sequence alignment results of rice blast resistance gene Pi9 with gene-specific SNP and C101A51-Pi9, Nip-Pi9 are as follows:

[0038] IRBL9-W-Pi9:GTTGATAAGTAAAACCT AGAAAAGAGGATGACGATGCGC;

[0039] C101A51-Pi9:GTTGATAAGTAAAACCT AGAAAAGAGGATGACGATGCGC;

[0040] Nip-Pi9...

Embodiment 2

[0075] Example 2: Application of resistance gene Pi9 gene-specific molecular markers in identifying different rice blast resistance genes in the Pi2 / 9 gene cluster region.

[0076] According to the polymorphic PCR product bands, the target gene Pi9 can be distinguished from the resistance genes on other Pi2 / 9 gene clusters. Such as figure 1 As shown, according to the position of the band, Pi9 can be distinguished from other resistance genes identified at this locus. The low band (108bp) indicates that it contains the Pi9 gene, and the high band (126bp) indicates that it does not contain Pi9. It can be seen that the test results are consistent with the design analysis, indicating that the resistance gene Pi9 gene-specific molecular markers can be applied in the identification of Pi9 gene and Pi2 / 9 gene cluster alleles.

Embodiment 3

[0077] Example 3: Detection application of resistance gene Pi9 gene-specific molecular markers in other rice varieties in South China

[0078] Select 13 important rice varieties in South China, in order: Zhenshan 97B, Gufeng B, Wufeng B, Tianfeng B, Xieqingzao B, Digu B, Fuyi B, Guanghui 880, Batai Xiangzhan, Huahang Simiao, Kangbaixiangzhan, Fengbazhan, and Maba Yinzhan.

[0079] Zhenshan 97B has been disclosed in the literature "Li Daopin et al., Comparative study on the seed production yield of Zhenshan 97B improved new male sterile line and Zhenshan 97A. Hybrid rice, 2012 Issue 03, pp. 28-29";

[0080] Gu Feng B and Fu Yi B have been published in the literature "Huang Lixing et al., Classical genetic analysis of resistance genes of rice blast-resistant rice parents. Journal of Fujian Agriculture and Forestry University (Natural Science Edition), 2011, 03, pp. 225-230 "Disclosed in;

[0081] Wufeng B has been disclosed in the document "Liang Shihu et al., Breeding of high...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof. The molecular marker Pi9SNP is prepared by amplifying from total DNA (Deoxyribonucleic Acid) of a rice blast resistant variety with rice blast resistance gene Pi9 by using a primer pair F1 and R1 so as to obtain a nucleotide segment I, and carrying out digestion on the nucleotide segment I by using restriction enzyme Hind III, so as to obtain a nucleotide segment II which is in specificity banding pattern with the obtained rice blast resistance gene Pi9. The molecular marker is the first one which is developed for marking Pi9 gene specificity SNP (Signal Nucleotide Polymorphism) for an internal sequence of the Pig gene, and has the following advantages that the specificity is high, the cost is low and the flux is high in practical application, and the molecular marker is widely applied to colonies of different genetic backgrounds. By utilizing the molecular marker, the efficiency in auxiliary molecular marker selective breeding, gene pyramiding breeding and transgenosis breeding is improved.

Description

technical field [0001] The invention relates to the field of agricultural biotechnology, in particular to the field of rice blast technology, in particular to a rice blast resistance gene Pi9 gene-specific molecular marker Pi9SNP and its preparation and application. Background technique [0002] Rice is one of the most important food crops in the world, and more than half of the population uses rice as a staple food. Rice blast caused by Magnapothe oryzae is one of the most serious diseases to rice production, causing serious grain loss every year. From the point of view of environmental protection and agricultural sustainable development, breeding and utilizing disease-resistant varieties is the safest and most effective way to control rice blast. In addition, due to the frequent pathogenic variation of rice blast physiological races, the resistance of single-resistant varieties will gradually lose within 3 to 5 years after planting (Yin Desuo et al., 2011). Broad-spectru...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor华丽霞苏菁朱小源陈深曾列先汪文娟汪聪颖杨健源
OwnerPLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI