Genetic marker for character of litter size of pig utilizing SLA-11 gene

A technology of genetic markers and litter size, applied in genetic engineering, plant gene improvement, recombinant DNA technology, etc., can solve the problems of slow progress in reproductive traits and low heritability of sows

Inactive Publication Date: 2013-12-04
HUAZHONG AGRI UNIV +1
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] The reproductive traits of sows are one of the important economic traits of pigs, but due to their low heritability and limited traits, the progress of routine selection of sows' reproductive traits has been slow

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic marker for character of litter size of pig utilizing SLA-11 gene
  • Genetic marker for character of litter size of pig utilizing SLA-11 gene
  • Genetic marker for character of litter size of pig utilizing SLA-11 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Obtaining of swine SLA-11 gene fragments and establishment of polymorphism detection method

[0032]Log in to the Ensembl database (http: / / asia.ensembl.org / Sus_scrofa / Info / Index) to download the porcine SLA-11 gene sequence as the target sequence, and use the Primer5 software to design primers online. The primer sequences are shown in the sequence table as SEQ ID NO: 11 and Shown in SEQ ID NO: 12, details are as follows: SLA-2-PF: GGAGGAGAATGTTAGATTGAGTT, SLA-2-PR: AGGGCAGTGAAGTTAAGATAAGG. The amplified region includes the 1813bp genomic nucleotide sequence of the third intron of the porcine SLA-11 gene, as shown in SEQ ID NO:1. The PCR reaction system was 25 μl, in which the template DNA was 50 ng, the concentration of dNTPs was 200 μmol / L, the concentration of each primer was 0.4 μmol / L, 3 U of Taq DNA polymerase (Biostar International, Canada), and deionized water was added to a total volume of 25 μl ;PCR reaction program: pre-denaturation at 94°C for 4mi...

Embodiment 2

[0034] Example 2: Polymorphic distribution of genetic markers of the present invention in different pig herds

[0035] The method for extracting pig genome DNA (pig samples are shown in Table 1) is carried out with reference to Xiong Yuan's "Introduction to Pig Biochemistry and Molecular Genetic Experiments" China Agricultural Press, 1999 edition.

[0036] The PCR-MspI-RFLP polymorphism of the porcine SLA-11 gene was detected in 11 populations of pigs, and the detection results are shown in Table 1. The results showed that there were 3 genotypes in pig breeds such as Large White II (Nongke) and DIV. In all 11 populations tested, the allele frequency was 66.35%-100.00%, and the C allele was the dominant allele (see Table 1).

[0037] Table 1 Distribution results of pig SLA-11 gene PCR-MspI-RFLP in different pig breeds

[0038]

[0039]

[0040] Table 1 shows that the materials of the above populations are all breeds publicly promoted in China, among which: Large White P...

Embodiment 3

[0041] Example 3: Association analysis of genetic markers prepared by the present invention and litter size traits

[0042] In order to determine whether the pig SLA-11 gene PCR-MspI-RFLP is related to the difference in pig litter size, 117 new Chinese lean pig lines DIV line established by the Key Laboratory of Pig Genetics and Breeding of the Ministry of Agriculture of Huazhong Agricultural University and Hubei Academy of Agricultural Sciences were selected. The 264 Large White pig herds established by the Animal Husbandry and Veterinary Research Institute were used as test materials. The MspI-RFLP method established in Example 2 was used for polymorphism detection, and the correlation between different genotypes of pig MspI-RFLP and pig litter size traits was analyzed. The SAS statistical software (SAS Institute Inc, Version 8.0) GLM program was used for single-marker analysis of variance, and the REG program was used to calculate the additive effect and dominant effect of g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of manufacturing of animal genetic markers, and particularly relates to the technical field of single nucleotide polymorphism (SNP) detection at the 3908 bp of the third intron of the pig SLA-11 gene. A method for screening the genetic marker for character of litter size of the pig comprises the following steps: extracting a genome DNA from pig blood, designing a primer, performing PCR amplification, cloning PCR products, measuring sequence, comparing and analyzing the sequence, performing SNP detection, marking, conducting correlation analysis among the characters of litter sizes. According to the invention, the DNA sequence in the third intron zone of the pig SLA-11 gene, the SNP genotyping detection, and the genetic marker are obtained; the nucleotide sequence is shown in SEQ ID NO: 1-10; base mutations (C / T) exist at the position of 68 bp in the sequence table of SEQ ID NO: 1-10, and lead to the polymorphism of the MspI-RFLP. The invention further discloses a manufacturing method and application of the genetic marker.

Description

technical field [0001] The invention relates to the technical field of preparation of pig genetic markers, in particular to a SLA-11 gene as a genetic marker for pig litter size traits and its application, which includes a detection method and application of pig SLA-11 gene mutation sites. Background technique [0002] The reproductive traits of sows are one of the important economic traits of pigs, but due to their low heritability and limited traits, the progress of conventional selection of sows' reproductive traits has been slow. With the rise and rapid development of molecular biology techniques, a combination of conventional breeding and marker-assisted selection (MAS) has been developed, which can effectively accelerate the selection of piglet size traits. At present, the methods of molecular marker identification mainly include genome scanning method and candidate gene method. Differentially expressed genes can be studied as candidate genes if they meet the followin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/11C12Q1/68
Inventor李凤娥杨嘉豪陶虎梅书棋周佳伟彭先文朱丽华官凯峰李严
OwnerHUAZHONG AGRI UNIV