Method for separating high-purity circulating tumor cells from blood

A tumor cell, high-purity technology, applied in the field of biological and medical detection, can solve the problems of non-specific adsorption, time-consuming and labor-intensive, low purity of circulating tumor cells, etc., and achieves the effect of simple operation, high cutting efficiency and large exposure area.

Active Publication Date: 2014-03-19
SHANGHAI JIAO TONG UNIV
View PDF5 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, in addition to the capture efficiency of these methods still needs to be improved, there is also a serious problem of non-specific adsorption. Even if the red blood cells in the blood are removed by lysis, centrifugation or other microfluidic chip technology methods, the remaining white blood cells will still be in large quantities. The non-specific adsorption of leukocytes on the capture surface leads to low purity of circulating tumor cells in the captured cells. It is necessary to distinguish the non-specifically adsorbed leukocytes from circulating tumor cells one by one by later immunostaining, which takes a lot of time and manpower, and It is easy to be interfered by false-positive or false-negative staining results and lead to misjudgment, thereby affecting the detection results and the prognosis of cancer based on them

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for separating high-purity circulating tumor cells from blood

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Release of Circulating Tumor Cells by Photosensitive Group and Ultraviolet Light Irradiation

[0042] M: AAAAAAAAAAGTCGAGGATTCTGAACCTGT;

[0043] M'-PC-NH 2 :

[0044] 5'-NH 2 - AAAAA-PCspacer-AAAAAACAGGTTCAGAATCCTCGAC-3';

[0045] M'-5PC-NH 2 :

[0046] 5, -NH 2 -PCspacer-AAAAAAAAAAACAGGTTCAGAATCCTCGAC-3'.

[0047] Wherein M is the polynucleotide loaded on the inner surface of the microchannel (see SEQ ID NO.1), M'-PC-NH- 2 (see SEQ ID NO.4) and M'-5PC-NH 2 (See SEQ ID NO.5) is a labeled single-stranded polynucleotide linked to the antibody, which can specifically bind to M. The PC spacer is a photosensitive group, which can be broken under the irradiation of a certain wavelength of light, preferably with a wavelength of 365 nanometers. M'-PC-NH 2 With M'-5PC-NH 2 The difference is that the photosensitive group is directly connected to the 5-terminal antibody, and is separated from the 5-terminal antibody by several nucleotide molecules. These po...

Embodiment 2

[0053] Example 2 Release of Circulating Tumor Cells by Restriction Endonucleases

[0054] A-EcoR1 (see SEQ ID NO.2): 5'-AAAAAAAAAAAAGAGCTAAGTCCGTAGAATTCAAAAAAAAAAGAGCTAAGTCCGTAGAATTCAAAAAAAAAAAAAA-3';

[0055] A-EcoRI′-NH 2 (see SEQ ID NO.6):

[0056] 5'-NH 2 -AAAAAAAAAAGAATTCTACGGACTTAGCTCCAGGAT-3';

[0057] B-BanHI (see SEQ ID NO.3): 5'-AAAAAAAAAAAATTGAATCATGCCTAGGATCCAAAAAAAAAATTGAATCATGCCTAGGATCCAAAAAAAAAAAAA-3';

[0058] B-BamHI′-NH 2 : (see SEQ ID NO.7) 5'-NH 2 -AAAAAAAAAAAGGATCCTAGGCATGATTCAATGAGGC-3';

[0059] Wherein A-EcoRI and B-BamHI are polynucleotides loaded on the inner surface of the microchannel, and A-EcoRI'-NH 2 with B-BamHI′NH 2 It is a labeled single-stranded polynucleotide linked to an antibody. A-EcoRI and A-EcoRI′-NH 2 There is a sequence that can be cut by the restriction endonuclease EcoRI, B-BamHI and B-BamHI'-NH 2 There is a sequence that can be cleaved by the restriction endonuclease BamHI in .

[0060] The capture method of tumor cells...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
Login to view more

Abstract

The invention discloses a method for separating high-purity circulating tumor cells from blood, comprising the following steps of: A. loading single chain polynucleotides on the surface of a micro channel of a micro fluidic chip, and enabling the surface of the micro channel to load an antibody by performing specific binding on polynucleotides and mark single chain polynucleotide in an antibody-mark single chain polynucleotide compound; B. contacting a blood sample with the antibody loaded on the surface of the micro channel of the micro fluidic chip, and separating the circulating tumor cells from blood by the combination of the antibody with surface specific antigens of the circulating tumor cells in the blood; and C. implementing release of the antibody and the captured circulating tumor cells from the surface of the micro channel by cutting a polynucleotide chain, thereby separating to obtain the high purity circulating tumor cells. The method provided by the invention can separate the high purity circulating tumor cells. If the released cells further pass through the loaded chip aiming at hemameba, the circulating tumor cells with sky-high purity can be obtained.

Description

technical field [0001] The invention relates to biological and medical detection, and relates to a method for isolating high-purity rare cells from mixed cell populations, in particular to a method for isolating high-purity circulating tumor cells from blood. Background technique [0002] Rare cells refer to cells that are rare in biological samples but have important biological functions or clinical detection significance, such as circulating tumor cells in human peripheral blood, circulating endothelial cells, cells infected by viruses, and tumors in solid tumors stem cells, etc. Due to the extremely rare number of rare cells, its detection is like finding a needle in a haystack, and its further analysis is more difficult. Therefore, it is urgent to develop methods and tools that can efficiently and quickly separate rare cells from complex biological samples. [0003] Circulating tumor cells (CTCs) in human peripheral blood are a representative type of rare cells, which r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/09
Inventor 施奇惠邓宇亮孙帅张瑜
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap