Nile tilapia apoptosis factor FasL gene and applications thereof

A technology of Nile tilapia and apoptotic factors, applied in the field of genetic engineering, can solve problems such as problems in aquaculture

Active Publication Date: 2014-03-19
SUN YAT SEN UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in recent years, serious diseases of Nile tilapia, especially streptococcal disease, have brought great troubles to the aquaculture industry, which makes it particularly important to study the mechanism of Nile tilapia disease treatment and subsequent prevention and treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nile tilapia apoptosis factor FasL gene and applications thereof
  • Nile tilapia apoptosis factor FasL gene and applications thereof
  • Nile tilapia apoptosis factor FasL gene and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Embodiment 1: the synthesis of the middle fragment of Nile tilapia FasL gene

[0070] According to the predicted Nile tilapia FasL mRNA sequence on GENBANK as a template for primer design, two pairs of primers were designed and synthesized. The upstream primer (Sense) in the first pair of primers is 20 bases from the 342nd base [5' - GTGGGACACGACGCATTCTG], the downstream primer (Anti-sense) is 17 bases from the 575th base [5'-ATCTCCCTGAGTGGCTGTGC]. The upstream primer (Sense) in the second pair of primers is 17 bases from the 128th base [5'- TGGTTGGCGTAGTGGTGCTG], and the downstream primer (Anti-sense) is 20 bases from the 448th base [ 5'-ACCTTAGAATCGCCCTTGGA]. Touch-down PCR The cDNA obtained by reverse transcription of the total RNA of the Nile tilapia head kidney was used as a template, and the original nucleotide sequences from 342nd to 591st and 128th to 467th were amplified by PCR. The reaction conditions were as follows: : Pre-denaturation at 95°C for 3 minut...

Embodiment 2

[0072] Embodiment 2: the synthesis of Nile tilapia FasL gene 5' end fragment

[0073] Two downstream primers Fa-5'-R1 and Fa-5'-R4 were designed based on the sequence of the sequenced FasL middle fragment for nested PCR. The first downstream primer (Fa-5'-R1) is 22 bases [5'-CCACTGAAGACAACCCGATA] from the 199th base of the sequenced FasL middle fragment sequence, and the second downstream primer (Fa-5' -R4) is 22 bases from the 4th base [5'-AATAAATGCAGCACCACTACGC]. For the first PCR, use the diluted PCR product (1:10) obtained in Example 1 above as a template, and amplify the nucleotide sequence from position 218 to the 5' end of the middle fragment by landing PCR method. The reaction conditions are: 94°C pre-denaturation 3 minutes; the bottom is 40 cycles, divided into two stages: (1) Denaturation at 94°C for 20 seconds, 0.5°C drop from 57°C to 47°C for each cycle, annealing for 20 seconds, a total of 20 cycles, and extension at 72°C for 50 seconds (2) Denaturation at 94°...

Embodiment 3

[0075] Embodiment 3: the synthesis of Nile tilapia FasL gene 3' end fragment

[0076] Two downstream primers Fa-3'-F1 and Fa-3'-F2 were designed according to the sequence of the sequenced FasL middle fragment for nested PCR. The first downstream primer (Fa-3'-F1) is 20 bases from the 320th base of the sequenced FasL middle fragment [5'- TCCAAGGGCGATTCTAAGGT], the second downstream primer (F Race F2) It is 20 bases from the 344th base [5'- ACTAGCCAGCAAGGTCCAGC]. For the first PCR, the diluted PCR product (1:10) obtained in Example 1 above was used as a template, and the nucleotide sequence from the 320th to the 5' end of the middle fragment was amplified by landing PCR method. The reaction conditions were: 94°C pre-denaturation 3 minutes; the bottom is 40 cycles, divided into two stages: (1) 94°C denaturation for 20 seconds, 0.4°C drop from 60°C to 52°C per cycle, annealing for 20 seconds, a total of 20 cycles, 72°C extension for 60 seconds (2) Denaturation at 94°C for 20 s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the genetic engineering technology field, and discloses to a nile tilapia apoptosis factor FasL gene, a vector containing the gene, recombined strains, recombined proteins, polyclonal antibodies and applications thereof. The gene employs total RNAs of a nile tilapia head-kidney as a template a gene segment with the nile tilapia apoptosis factor FasL gene full-length cDNA sequence is obtained through RT-PCR and RACE methods. The invention constructs a vector containing the gene and a recombined strain. Active nile tilapia apoptosis factor FasL gene recombined proteins with stable source and low cost are expressed by utilization of escherichia coli pronuclei. The apoptosis activity of the nile tilapia apoptosis factor FasL gene recombined proteins to Hela cells is also detected, and the recombined proteins can be further prepared into anticancer medicines. Anti-nile tilapia apoptosis factor FasL polyclonal antibodies are prepared, and the titer is determined, and the foundation for further development of a kit for quantitative detection of tilapia FasL is laid.

Description

Technical field [0001] The present invention is a genetic engineering technology field, which involves a kind of Nileo non -fish apoptosis factor FASL gene and the carrier containing the genes containing the gene and the application of the gene to prepare an immune agent or detect kit. Background technique [0002] FASL (CD95L) is an apoptotic ligand in an external apoptosis pathway in the apoptosis system. After combining the receptor FASR (ALAPO-1, CD95) protein on the target cells, target cell apoptosis is induced.FASL is mainly expressed in activated leukemia cells, peripheral blood T cells, macrophages, and even some non -immunomason tissues. FAS can be widely expressed on the surface of immune cells and physical tissue cells. [0003] FASL is II cross -membrane protein that can be cut into soluble forms and death receptors in the form of membrane binding or through the matrix dissolving factor (metal enzyme Matrilysin), but the apoptosis activity is lower than the FASL comb...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C12N15/63C12N15/70C12N1/21C07K14/46A61K38/17A61K48/00A61P35/00C12R1/19
Inventor吴金英马太洋李文笙
OwnerSUN YAT SEN UNIV