Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Mouse nerve growth factor-containing expression vector and cell

A nerve growth factor and cell technology, applied in the direction of nerve growth factor, growth factor/inducing factor, and cells modified by introducing foreign genetic material, can solve the problems of low expression, low activity, and reduced biological activity, etc., to achieve The sequence is correct, the expression level is high, and the activity is good.

Inactive Publication Date: 2015-06-24
NAT INST FOR FOOD & DRUG CONTROL
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the mNGF expressed by Escherichia coli is prone to misfolding, resulting in a decrease in biological activity, and the use of yeast, insect cells and mammalian cells to express NGF also has the problem of low expression or low activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mouse nerve growth factor-containing expression vector and cell
  • Mouse nerve growth factor-containing expression vector and cell
  • Mouse nerve growth factor-containing expression vector and cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] Example 1 Construction of vector pXL-mNGF

[0087] 1.1 Main reagents and instruments

[0088] NGF Mouse cDNA Clone was purchased from OriGene; Ultra-fidelity PCR kit was purchased from NEB Company; DNA Molecular Weight Markers DL15000 and DL2000 were purchased from TaKaRa Company; restriction enzymes EcoRV and PacI were purchased from NEB Company; agarose gel recovery kit (DP209) was purchased from Tiangen Biochemical Technology Co., Ltd.; T4DNA ligase was purchased from NEB Company; DH5α competent Escherichia coli was purchased from Tiangen Biochemical Technology Co., Ltd.; plasmid extraction kit ( Plus SV Minipreps DNA Purification System) was purchased from Promega Company.

[0089] 1.2 Method

[0090] 1.2.1 Obtain the target gene by PCR

[0091] Primer design:

[0092] Upstream primers:

[0093] TGCAGGATATCGCCACCATGTCCATGTTGTTCTACACTCTG (SEQ ID NO: 1)

[0094] Downstream primer: CCTTAATTAATCAGCCTCTTCTTGTAGCC (SEQ ID NO: 2)

[0095] Primers were synthesized...

Embodiment 2

[0127] Example 2 transient transfection

[0128] 2.1 Main reagents and instruments

[0129] CHO cells were purchased from Life Technology Company, the product number is A1155701; pEGFP-N1 plasmid was preserved in our laboratory; NGF extracted from mouse submandibular gland was purchased from China National Institutes of Food and Drug Control; transfection reagent FreeStyle TM MAX Reagent was purchased from life technology company; culture medium OptiPRO TM SFM was purchased from life technology company; serum-free medium CD Forti TM CHO was purchased from Life Technology Company; primary antibody: Anti-NGF antibody, purchased from Abcam Company; secondary antibody: Goat Anti-Rabbit IgG HRP Affinity Purified PAb was purchased from R&D Company; chemiluminescent color development kit: SuperSignal*West Femto Chemiluminescent Substrate , purchased from Fementas company. Fluorescence inverted microscope, model TE2000-U, NIKON.

[0130] 2.2 Method

[0131] 2.2.1 Transfection...

Embodiment 3

[0165] Example 3 Stable clone screening

[0166] 3.1 Main reagents and instruments

[0167] Amethopterin (MTX) was purchased from sigma-aldrich; Puromycin (Puromycin) was purchased from life technologies; glucose solution was purchased from sigma-aldrich. Cell counter, model countess automated cell counter, Invitrogen company.

[0168] 3.2 Method

[0169] 3.2.1 The first stage of screening

[0170] Count the CHO cells transfected for 48h, count live cells and total cells. Prepare two concentrations of selection medium: (1) add Puromycin to a final concentration of 10 μg / mL and MTX to a final concentration of 100 nM; (2) add Puromycin to a final concentration of 20 μg / mL and MTX to a final concentration of 200 nM. After the preparation is completed, the selection medium is preheated to 37°C for use, and the basic medium is CD Forti TM CHO medium was supplemented with 8 mM glutamine. Cells were harvested by centrifugation, resuspended in selection medium, and counted. Ad...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to an expression vector for expressing a growth factor and a cell, specifically, relates to a mouse nerve growth factor-containing recombinant vector and a recombinant cell, and also relates to a preparation method of the recombinant cell, a purification method of a mouse nerve growth factor and an application of the recombinant vector or the recombinant cell in preparation of the mouse nerve growth factor. The mouse nerve growth factor is successfully expressed by utilizing a mammalian cell expression system, and the mouse nerve growth factor is further proved to have correct sequence and higher specific activity, and has a good application prospect.

Description

technical field [0001] The present invention relates to expression vectors and cells for expressing growth factors. Specifically, the present invention relates to recombinant vectors and recombinant cells containing mouse nerve growth factor. The present invention also relates to the preparation method of said recombinant cells and the purification of mouse nerve growth factor. The method and the use of the recombinant vector or the recombinant cell for preparing mouse nerve growth factor. Background technique [0002] Nerve growth factor, NGF for short, is a secreted protein belonging to the neurotrophic factor family, which plays an important role in maintaining the survival of neurons and promoting their growth. NGF was first discovered by Rita Monterange in 1952. It was originally isolated from snake venom. Later, it was found that NGF is rich in rat submandibular gland and has a high specific activity. The process of extracting NGF from rat submandibular gland is relati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/85C12N5/10C12P21/02C07K14/48C07K1/18C07K1/16
Inventor 饶春明徐莉李永红韩春梅史新昌陶磊
Owner NAT INST FOR FOOD & DRUG CONTROL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com