Preparation method of vector for specific expression of miR-505 in central nervous system
A technology of egfp-mir-505 and the central nervous system, which is applied in the direction of introducing foreign genetic material using vectors, recombinant DNA technology, etc., can solve the problems of unrepeatable experimental results and easy loss of phenotypes, and achieve stable genetic characteristics and easy copy number , easily recognizable effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] 1) Acquisition of EGFP-mir-505 gene
[0030] Using pcDNA6.2-EGFP-miR505 as a template, PCR amplification was performed with the following pair of primers to obtain the EGFP-mir-505 gene with a length of about 1400bp, and its sequence is shown in SEQ ID NO:1.
[0031] Pegfp-miR-505forward:
[0032] GCGCATGCCTAGAGAACCCACTGCTTAC
[0033] Pegfp-miR-505reverse:
[0034] GCAAGCTTGCTATGGCAGGGCCTGCCG
[0035] System: (15ul)
[0036]
[0037] Program: 93°C 1min30s; (93°C 30s, 57°C 30s, 65°C 2min) *40; 65°C 10min
[0038] Recover the PCR product:
[0039]
concentration
A260 / A280
Pegfp-miR-505-3P
64.4 / 59.4ng / ul
1.88 / 1.89
Pegfp-NC
55.2 / 52.9ng / ul
1.89 / 1.93
[0040] PCR product double digestion reaction:
[0041]
[0042] PCR product nc810ng; 3p930ng
[0043] 37°C 3h; 65°C 20min
[0044] Purification and recovery of enzyme digestion products:
[0045] nc23.5 / 23.8ng / ul
[0046] 3p14.9 / 14.3ng / ul
[0047] 2) Const...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com