miRNA marker related to malignant transformation of colitis and proctitis and kit
A marker and kit technology, applied in the fields of biotechnology and medicine, to achieve high specificity, high sensitivity, and simple operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 Colitis-related cancer model Muc2 gene knockout mouse miRNA expression profile in colonic epithelial cells
[0040]Collection of intestinal epithelial cells from mice: select 3-month-old Muc2+ / + and Muc2- / -, each group includes four mice, kill the mice, wash the colon, cut it longitudinally, and place a section of each in 20ml ice-cold PBS; transfer the tissue into 30ml 15mM EDTA at 37°C; shake at 37°C, 220rpm, 30min, fully shake to remove intestinal tissue; centrifuge at 5000rpm, 5min at 4°C; first discard the supernatant, resuspend the cells in 5ml cold PBS, and aliquot Put in a 1.5ml EP tube; centrifuge at 4°C, 3000rpm, 5min; discard the supernatant, uncap the EP tube and place in liquid nitrogen; take it out and place it at -80°C overnight, and cap the EP tube the next day.
[0041] Extraction of total RNA: total RNA was extracted with Trizol reagent (Invitrogen, Carlsbad, CA) according to the operation manual.
[0042] miRNA array (expression profile): T...
Embodiment 2
[0044] Example 2 Expression of cytokines and verification of differentially expressed miRNA in colonic epithelial cells of Muc2 mice
[0045] Mouse colonic epithelial cell RNA extraction is the same as in Example 1;
[0046] qRT-PCR was used to detect the expression level of cytokine mRNA, reaction system: forward primer (20 μm) 0.15 μl, reverse primer (20 μm) 0.15 μl, cDNA 0.7 μl, H 2 O9 μl, fluorescent dye SYBR Green (2×) 10 μl; reaction conditions: 50°C for 2min, 95°C for 2min; denaturation at 95°C for 15sec, annealing / extension at 60°C for 1min, a total of 40 cycles.
[0047] Cytokine mRNA expression levels as figure 2 Shown: Compared with the control, the expression levels of several cytokines IL-6, COX-2, IL-10, TNFα, IL-1β in the colonic epithelial cells of Muc2- / - mice were significantly increased.
[0048] IL-6:
[0049] Forward primer: TAGTCCTTCCTACCCCAATTTCC,
[0050] Reverse primer: TTGGTCCTTAGCCACTCCTTC;
[0051] COX-2:
[0052] Forward primer: TGAGCAACTATT...
Embodiment 3
[0104] Example 3 collection of human colon cancer tissue samples
[0105] 16 pairs of colorectal cancer tissues, 6 pairs of colitis tissues and their paired normal tissues were collected from the First Affiliated Hospital of Xinxiang Medical College and the Affiliated Central Hospital of Xinxiang Medical College, and the specimens were stored at -80°C.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 