Quantitative analysis method for Lactobacillus crustorum, Clostridium butyricum and Bacillus amyloliquefaciens in fermented grain microbial flora
A microbial community, Bacillus technology, applied in the field of bioengineering, can solve the problems of lack of reasonable and fast methods for quantitative detection of microorganisms, time-consuming and laborious, and lack of stability and reliability of detection results.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] The preparation of embodiment 1 standard curve
[0034] 1. Synthesize specific primers for lactic acid bacteria, Clostridium, and Bacillus, and specifically amplify the screened lactic acid bacteria, Clostridium, and Bacillus
[0035] Lactic acid bacteria specific primer sequence (5'→3'):
[0036] Lacto-F: AGAACACCAGTGGCGAAGG
[0037] Lacto-R: CAGGCGGAGTGCTTAATGC
[0038] Clostridium-specific primer sequence (5′→3′):
[0039] Clost-F: AAAGGRAGATTAATACCGCATAA
[0040] Clost-R: TTCTTCCTAATCTCTACGCA
[0041] Bacillus-specific primer sequence (5′→3′):
[0042]Bacil-F: ATGGCTGTCGTCAGCT
[0043] Bacil-R: ACGGGCGGTGTGTAC
[0044] R in the above primers is A or G.
[0045] The amplified products were detected by 2.0% agarose gel electrophoresis. The target fragment size of lactic acid bacteria was 170bp, the target fragment of Clostridium was about 540bp, and the target fragment of Bacillus was about 300bp. The PCR products were recovered by tapping gel.
[0046] 2. Sc...
Embodiment 2
[0086] The preparation of embodiment 2 standard samples
[0087] 1. Collection of samples of fermented grains
[0088] Collect samples of fermented grains. If the DNA cannot be extracted in time after the sample is collected, it should be stored in a -80°C refrigerator immediately.
[0089] 2. Extraction method of microbial total DNA in fermented grains
[0090] Weigh 1g of fermented grains sample into a 50mL centrifuge tube, add 5mL of PBS buffer solution pH7.64 and 8-9 sterilized glass beads to the centrifuge tube, vortex for 5min, centrifuge at 200×g for 5min, and absorb the supernatant. Add 5mL PBS buffer solution to the precipitate and repeat washing twice, combine the three supernatants (operated on ice), centrifuge at 12000rpm for 5min, and take the precipitate. Add 1mL CTAB extract (2%CTAB, 5mol / L NaCl, 1mol / LTris-HCl(pH8.0), 0.5mol / L EDTA) and 20μL mercaptoethanol to the centrifuge tube, shake at 65°C for 30min , add 5 μL of proteinase k (20 mg / mL), centrifuge at 6...
Embodiment 3
[0092] Quantitative Analysis of Lactic Acid Bacteria, Clostridium, and Bacillus in Example 3 Fermented Grains Microflora
[0093] Quantification of lactic acid bacteria, Clostridium, and Bacillus in the fermented grains sample: use the total DNA of the fermented grains obtained in Example 2, and use specific primers for lactic acid bacteria, Clostridium, and Bacillus in Example 1. Daqu fluorescent quantitative PCR analysis was performed according to the fluorescent quantitative PCR reaction system and PCR program in Example 1.
[0094] Quantification of lactic acid bacteria in wine fermented grains sample: according to the linear equation y=-0.3411x+14.07 (R 2 =0.9978) to calculate the copy number of lactic acid bacteria in fermented grain samples at different time points, so as to obtain the change trend of lactic acid bacteria biomass in the liquor fermentation process (such as figure 1 shown).
[0095] Quantification of Clostridia in wine grains samples: according to the ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More