Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for early screening and diagnosis of prostate cancer

A technology for prostate cancer and kits, applied in the field of kits for screening and diagnosing prostate cancer, molecular markers for early screening and diagnosis of prostate cancer, and kits, which can solve problems such as insufficient stability, defects, and elevated PSA , to achieve the effect of reducing clinical costs and complications, high sensitivity and specificity, and improving the diagnostic rate of puncture

Active Publication Date: 2014-08-27
广州立柏生物技术有限公司
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, PSA has the following defects: the prostate specific antigen is specific to the prostate gland itself, but not to the prostate tumor
There is still a clinical problem: nearly 30% of prostate cancer patients may not increase PSA, but only fluctuate within the normal range (that is, PSA<4.0ng / ml)
But only 60% of prostate cancers are detected by transabdominal MRI
[0008] (5) Other molecular markers include HK-2, PSMA, p27 gene and IGF-1, etc. It is reported that these genes are related to the grade and stage of prostate cancer, but they lack prostate cancer specificity and sensitivity is not high
But these molecular markers are difficult to use to diagnose prostate cancer
[0009] To sum up, it can be seen that there are many defects in the existing inspection methods: the existing technology cannot diagnose prostate cancer and urine markers in the early stage from the blood test, and can only diagnose ERG fusion gene-positive prostate cancer and the stability is not enough; especially for those who meet the needs of the world Weaknesses in the Large Clinical and Societal Needs of Health Screening in the Elderly Male Population
There is still a lack of effective serological markers and other simple and effective methods to diagnose prostate cancer; in addition, the existing methods for diagnosing prostate cancer have low sensitivity and specificity, and cannot be used to diagnose early prostate cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for early screening and diagnosis of prostate cancer
  • Kit for early screening and diagnosis of prostate cancer
  • Kit for early screening and diagnosis of prostate cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Primers

[0032] In the embodiment of the present invention, the primers designed according to ITGB5, TMEM176B, TIMP1 and 18S genes are as follows:

[0033] The ITGB5 primer pair is shown in SEQ ID NO:1 and SEQ ID NO:2, respectively:

[0034] Sense primer: GGAAGTTCGGAAACAGAGGGT;

[0035] Antisense primer: CTTTCGCCAGCCAATCTTCTC;

[0036] The amplified fragment is 106bp.

[0037] The TMEM176B primer pair is shown in SEQ ID NO:3 and SEQ ID NO:4, respectively:

[0038] Sense primer: ATGACGCAAAACACGGTGATT;

[0039] Antisense primer: GCAGTTGTGTCAAAGCTGACT;

[0040] The amplified fragment is 109bp.

[0041] The TIMP1 primer pair is shown in SEQ ID NO:5 and SEQ ID NO:6, respectively:

[0042] Sense primer: CATCCTGTTGTTGCTGTGGC;

[0043] Antisense primer: AACTTGGCCCTGATGACGAG;

[0044] The amplified fragment is 108bp.

[0045] The 18S primer pair is shown in SEQ ID NO:7 and SEQ ID NO:8, respectively:

[0046] Sense primer: CCTGGATACCGCAGCTAGGA;

[0047] An...

Embodiment 2

[0049] Example 2: Method steps using ITGB5, TMEM176B and TIMP1 as target genes

[0050] 1. Extraction of peripheral blood RNA

[0051] In the present invention, the extraction of RNA in the blood all uses the Life kit, and β-mercaptoethanol and absolute ethanol are also used. The reagents and the amounts of the reagents used in this embodiment are only exemplary, and those skilled in the art can make corresponding adjustments according to actual conditions. Unless otherwise specified, all enzyme-free water, EP tubes, and pipette tips used were treated with enzyme-free and sterilized by high-pressure steam.

[0052] Before extracting total RNA from peripheral blood, prepare whole blood sample cell lysate containing 1% β-mercaptoethanol. To prepare enough solution to extract RNA from no more than 0.2ml of whole blood, add 2ul of β-mercaptoethanol to 0.2ml of cell lysate. The specific steps for extracting total RNA from 0.2ml fresh whole blood are as follows:

[0053] 1) Take...

Embodiment 3

[0089] Embodiment 3: The method steps of using ITGB5 and TMEM176B as target genes

[0090] Screen and diagnose prostate cancer with ITGB5 and TMEM176B as the target genes. During the real-time fluorescent quantitative PCR analysis and detection process, the target genes are selected as ITGB5 and TMEM176B. The upper and lower primers of ITGB5 are SEQ ID NO: 1 and SEQ ID NO: 2, respectively , the upper and lower primers of TMEM176B are respectively SEQ ID NO:3 and SEQ ID NO:4. The calculation method of the results is: the diagnostic model of prostate cancer is expressed as Riskscore=1.21×ΔCTTMEM16B-0.67×ΔCTITGB5-6.35, the corresponding diagnostic threshold of prostate cancer is -0.47, and the risk score value greater than -0.47 is diagnosed as prostate cancer, and the corresponding The sensitivity is 90.7%, the specificity is 92.7%; the prediction model of indolent prostate cancer is expressed as Risk score=23.67+1.07×ΔCTTMEM176B-2.72×ΔCTITGB5, the corresponding diagnostic thres...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a kit for early screening and diagnosis of prostate cancer. The kit comprises upstream and downstream primers of at least two genes of ITGB5, TMEM176B and TMP1, wherein an ITGB5 primer pair is as shown in SEQ ID NO:1 and SEQ ID NO:2; a TMEM176B primer pair is as shown in SEQ ID NO:3 and SEQ ID NO:4; a TIMP1 primer pair is shown in SEQ ID NO:5 and SEQ ID NO:6. The kit disclosed by the invention has ultra-high sensitivity and specificity on the prostate cancer, not only can be used for early diagnosis of the prostate cancer, but also can be used for identifying indolent prostate cancers and actively monitoring the progression of prostate cancer diseases.

Description

technical field [0001] The present invention relates to a kit for screening and diagnosing prostate cancer. Specifically, the present invention relates to a molecular marker for early screening and diagnosis of prostate cancer, a kit, and a method for using the kit. Background technique [0002] Cancer morbidity and mortality: According to the 2012 national cancer registration area incidence rate (crude rate) of 285.91 / 100,000, the standardized rate of China's population is 146.87 / 100,000, and the cumulative rate (0-74 years old) is 22.08%. The mortality rate (crude rate) of malignant tumors in the national tumor registration area is 180.54 / 100,000, the standardized rate of China's population is 85.06 / 100,000, and the cumulative rate of cancer deaths among Chinese residents (0-74 years old) is 12.94%. Therefore, it is extremely urgent to improve the ability of early diagnosis and comprehensive prevention and treatment of tumors. [0003] Prostate cancer is the most common ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6886C12Q2600/106C12Q2600/158
Inventor 高新庞俊冯映红
Owner 广州立柏生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com