Kit for early screening and diagnosis of prostate cancer
A technology for prostate cancer and kits, applied in the field of kits for screening and diagnosing prostate cancer, molecular markers for early screening and diagnosis of prostate cancer, and kits, which can solve problems such as insufficient stability, defects, and elevated PSA , to achieve the effect of reducing clinical costs and complications, high sensitivity and specificity, and improving the diagnostic rate of puncture
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1: Primers
[0032] In the embodiment of the present invention, the primers designed according to ITGB5, TMEM176B, TIMP1 and 18S genes are as follows:
[0033] The ITGB5 primer pair is shown in SEQ ID NO:1 and SEQ ID NO:2, respectively:
[0034] Sense primer: GGAAGTTCGGAAACAGAGGGT;
[0035] Antisense primer: CTTTCGCCAGCCAATCTTCTC;
[0036] The amplified fragment is 106bp.
[0037] The TMEM176B primer pair is shown in SEQ ID NO:3 and SEQ ID NO:4, respectively:
[0038] Sense primer: ATGACGCAAAACACGGTGATT;
[0039] Antisense primer: GCAGTTGTGTCAAAGCTGACT;
[0040] The amplified fragment is 109bp.
[0041] The TIMP1 primer pair is shown in SEQ ID NO:5 and SEQ ID NO:6, respectively:
[0042] Sense primer: CATCCTGTTGTTGCTGTGGC;
[0043] Antisense primer: AACTTGGCCCTGATGACGAG;
[0044] The amplified fragment is 108bp.
[0045] The 18S primer pair is shown in SEQ ID NO:7 and SEQ ID NO:8, respectively:
[0046] Sense primer: CCTGGATACCGCAGCTAGGA;
[0047] An...
Embodiment 2
[0049] Example 2: Method steps using ITGB5, TMEM176B and TIMP1 as target genes
[0050] 1. Extraction of peripheral blood RNA
[0051] In the present invention, the extraction of RNA in the blood all uses the Life kit, and β-mercaptoethanol and absolute ethanol are also used. The reagents and the amounts of the reagents used in this embodiment are only exemplary, and those skilled in the art can make corresponding adjustments according to actual conditions. Unless otherwise specified, all enzyme-free water, EP tubes, and pipette tips used were treated with enzyme-free and sterilized by high-pressure steam.
[0052] Before extracting total RNA from peripheral blood, prepare whole blood sample cell lysate containing 1% β-mercaptoethanol. To prepare enough solution to extract RNA from no more than 0.2ml of whole blood, add 2ul of β-mercaptoethanol to 0.2ml of cell lysate. The specific steps for extracting total RNA from 0.2ml fresh whole blood are as follows:
[0053] 1) Take...
Embodiment 3
[0089] Embodiment 3: The method steps of using ITGB5 and TMEM176B as target genes
[0090] Screen and diagnose prostate cancer with ITGB5 and TMEM176B as the target genes. During the real-time fluorescent quantitative PCR analysis and detection process, the target genes are selected as ITGB5 and TMEM176B. The upper and lower primers of ITGB5 are SEQ ID NO: 1 and SEQ ID NO: 2, respectively , the upper and lower primers of TMEM176B are respectively SEQ ID NO:3 and SEQ ID NO:4. The calculation method of the results is: the diagnostic model of prostate cancer is expressed as Riskscore=1.21×ΔCTTMEM16B-0.67×ΔCTITGB5-6.35, the corresponding diagnostic threshold of prostate cancer is -0.47, and the risk score value greater than -0.47 is diagnosed as prostate cancer, and the corresponding The sensitivity is 90.7%, the specificity is 92.7%; the prediction model of indolent prostate cancer is expressed as Risk score=23.67+1.07×ΔCTTMEM176B-2.72×ΔCTITGB5, the corresponding diagnostic thres...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Sensitivity | aaaaa | aaaaa |
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com