Kits for Early Screening and Diagnosis of Prostate Cancer
A prostate cancer and kit technology, which is applied in the field of molecular markers for early screening and diagnosis of prostate cancer, kits for screening and diagnosis of prostate cancer, and kits, can solve problems such as insufficient stability, defects, and elevated PSA. , to achieve the effect of reducing clinical costs and complications, high sensitivity and specificity, and improving the rate of puncture diagnosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1: Primers
[0032] In the embodiment of the present invention, the primers designed according to ITGB5, TMEM176B, TIMP1 and 18S genes are as follows:
[0033] The ITGB5 primer pair is shown in SEQIDNO:1 and SEQIDNO:2, respectively:
[0034] Sense primer: GGAAGTTCGGAAACAGAGGGT;
[0035] Antisense primer: CTTTCGCCAGCCAATCTTCTC;
[0036] The amplified fragment is 106bp.
[0037] The TMEM176B primer pair is shown in SEQIDNO:3 and SEQIDNO:4, respectively:
[0038] Sense primer: ATGACGCAAAACACGGTGATT;
[0039] Antisense primer: GCAGTTGTGTCAAAGCTGACT;
[0040] The amplified fragment is 109bp.
[0041] The TIMP1 primer pair is shown in SEQIDNO:5 and SEQIDNO:6, respectively:
[0042] Sense primer: CATCCTGTTGTTGCTGTGGC;
[0043] Antisense primer: AACTTGGCCCTGATGACGAG;
[0044] The amplified fragment is 108bp.
[0045] The 18S primer pair is shown in SEQIDNO:7 and SEQIDNO:8, respectively:
[0046] Sense primer: CCTGGATACCGCAGCTAGGA;
[0047] Antisense primer: ...
Embodiment 2
[0049] Example 2: Method steps using ITGB5, TMEM176B and TIMP1 as target genes
[0050] 1. Extraction of peripheral blood RNA
[0051] In the present invention, the extraction of RNA in the blood all uses the Life kit, and β-mercaptoethanol and absolute ethanol are also used. The reagents and the amounts of the reagents used in this embodiment are only exemplary, and those skilled in the art can make corresponding adjustments according to actual conditions. Unless otherwise specified, all enzyme-free water, EP tubes, and pipette tips used were treated with enzyme-free and sterilized by high-pressure steam.
[0052] Before extracting total RNA from peripheral blood, prepare whole blood sample cell lysate containing 1% β-mercaptoethanol. To prepare enough solution to extract RNA from no more than 0.2ml of whole blood, add 2ul of β-mercaptoethanol to 0.2ml of cell lysate. The specific steps for extracting total RNA from 0.2ml fresh whole blood are as follows:
[0053] 1) Take...
Embodiment 3
[0089] Embodiment 3: The method steps of using ITGB5 and TMEM176B as target genes
[0090] Screening and diagnosing prostate cancer with ITGB5 and TMEM176B as the target genes, the target genes were selected as ITGB5 and TMEM176B during the real-time fluorescent quantitative PCR analysis and detection process, the upper and lower primers of ITGB5 were SEQ ID NO: 1, SEQ ID NO: 2, and the upper and lower primers of TMEM176B , The lower primers are respectively SEQ ID NO: 3, SEQ ID NO: 4. The calculation method of the results is: the diagnostic model of prostate cancer is expressed as Riskscore=1.21×ΔCTTMEM16B-0.67×ΔCTITGB5-6.35, the corresponding diagnostic threshold of prostate cancer is -0.47, and the risk score value greater than -0.47 is diagnosed as prostate cancer, and the corresponding The sensitivity is 90.7%, and the specificity is 92.7%. The prediction model of indolent prostate cancer is expressed as Riskscore=23.67+1.07×ΔCTTMEM176B-2.72×ΔCTITGB5, and the correspondin...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Sensitivity | aaaaa | aaaaa |
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com