HPV nucleic acid detection kit based on enzyme-linked immunosorbent assay and application of HPV nucleic acid detection kit
An enzyme-linked immunoassay and detection kit technology, applied in the fields of immunology, nucleic acid chemistry, and molecular biology, can solve problems such as difficulties, complicated operations, and inability to truly reflect the viral load, achieving low cost and no need Effect of Amplification and Detection Instruments
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0044] Specific examples are provided below to further illustrate the technical solution of the present invention, but the application of the technology of the present invention is not limited to the examples.
[0045] Cloning, sequence analysis and in vitro transcription of 1HPV16 E6 and E7 gene fragments
[0046] Extract the genomic DNA in the disease sample, PCR amplify the HPV16 type E6, E7 gene (296bp-477bp length range), with the HPV16 type E6, E7 ORF primer sequence (5'-3') of the T7RNA Polyase promoter (underlined part) : HPV16E6 gene upstream primer TAATACGACTCACTATAGGG ATGCACCAAAAGAGAACTGCAATGTTTCAG, HPV16E6 gene downstream primer TTACAGCTGGGTTTCTCTACGTGTTCTTG; HPV16E7 gene upstream primer TAATACGACTCACTATAGGG ATGCATGGAGATACACCTACATTGCAT, HPV16E7 gene downstream primer TTATGGTTTCTGAGAACAGATGGGGCACAC.
[0047] PCR reaction system: a single reaction contains 2.5uL 10×PCR Buffer, 1uL 2.5mM each dNTP Mix, 2uL 25mM MgCl 2 , 0.4uL Taq polymerase (5U / μL), 1uL Sense prime...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com