HPV nucleic acid detection kit based on enzyme-linked immunosorbent assay and application of HPV nucleic acid detection kit

An enzyme-linked immunoassay and detection kit technology, applied in the fields of immunology, nucleic acid chemistry, and molecular biology, can solve problems such as difficulties, complicated operations, and inability to truly reflect the viral load, achieving low cost and no need Effect of Amplification and Detection Instruments

Inactive Publication Date: 2014-09-03
NANJING UNIV
View PDF6 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The problem to be solved in the present invention: for the deficiencies of the existing HPV nucleic acid detection methods, such as relatively complicated operation and high cost caused by difficulties, corresponding amplification and detection instruments are required, and the initial viral load cannot be truly reflected. quantity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HPV nucleic acid detection kit based on enzyme-linked immunosorbent assay and application of HPV nucleic acid detection kit
  • HPV nucleic acid detection kit based on enzyme-linked immunosorbent assay and application of HPV nucleic acid detection kit
  • HPV nucleic acid detection kit based on enzyme-linked immunosorbent assay and application of HPV nucleic acid detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0044] Specific examples are provided below to further illustrate the technical solution of the present invention, but the application of the technology of the present invention is not limited to the examples.

[0045] Cloning, sequence analysis and in vitro transcription of 1HPV16 E6 and E7 gene fragments

[0046] Extract the genomic DNA in the disease sample, PCR amplify the HPV16 type E6, E7 gene (296bp-477bp length range), with the HPV16 type E6, E7 ORF primer sequence (5'-3') of the T7RNA Polyase promoter (underlined part) : HPV16E6 gene upstream primer TAATACGACTCACTATAGGG ATGCACCAAAAGAGAACTGCAATGTTTCAG, HPV16E6 gene downstream primer TTACAGCTGGGTTTCTCTACGTGTTCTTG; HPV16E7 gene upstream primer TAATACGACTCACTATAGGG ATGCATGGAGATACACCTACATTGCAT, HPV16E7 gene downstream primer TTATGGTTTCTGAGAACAGATGGGGCACAC.

[0047] PCR reaction system: a single reaction contains 2.5uL 10×PCR Buffer, 1uL 2.5mM each dNTP Mix, 2uL 25mM MgCl 2 , 0.4uL Taq polymerase (5U / μL), 1uL Sense prime...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical fields of molecular biology, immunology and nucleic acid chemistry, and particularly relates to an HPV nucleic acid detection kit based on enzyme-linked immunosorbent assay and application of the HPV nucleic acid detection kit. The kit is based on an immunoassay method for detecting high-risk HPV16 type E6 and E7 RNA by using an Sdr monoclonal antibody; a detection process is realized as follows: amplification of a target sequence by using technologies such as inverse transcription and PCR is not needed, an unlabelled DNA probe is used for being hybridized with the HPV16 type E6 and E7 RNA to form a DNA:RNA heterozygote, and then the heterozygote is recognized by using the Sdr monoclonal antibody, and subsequent signal multiplication is performed. A detection method has the advantages of high speed, low cost, high sensitivity, and no need of complicated amplification and detection instruments, and is capable of detecting an initial viral load.

Description

technical field [0001] The invention belongs to the technical fields of molecular biology, immunology and nucleic acid chemistry. In particular, it relates to an enzyme-linked immunoassay-based HPV nucleic acid detection kit and an application thereof. Background technique [0002] Human papillomavirus (hereinafter referred to as HPV) is a circular double-stranded DNA virus belonging to the family Papillomaviridae and the genus Alphapapillomavirus. Since it was first discovered in the 1970s, more than 100 genotypes of HPV have been published. Some of these genotypes have been shown to be associated with various epithelial or mucosal malignancies, especially cervical cancer. Cervical cancer is the second most common malignancy after breast cancer among women worldwide. In the United States, 12,000 women are diagnosed with cervical cancer each year. It is now well established that HPV is the cause of almost all cervical cancers worldwide. HPV causes 99% of cervical cancer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): G01N33/577G01N33/569G01N33/535
CPCC12Q1/6804C12Q1/70C12Q2527/143C12Q2527/101C12Q2527/125
Inventor 沈萍萍丁森卢彦
Owner NANJING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap