A kind of hpv nucleic acid detection kit and its application based on enzyme-linked immunoassay
An enzyme-linked immunoassay and detection kit technology, which is applied in the fields of immunology, nucleic acid chemistry, and molecular biology, can solve the problems of complex operation, difficulty, and high cost, and achieve the effect of no need for amplification and detection equipment and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0044] Specific embodiments are provided below to further illustrate the technical solutions of the present invention, but the application of the technology of the present invention is not limited to the embodiments.
[0045] 1HPV16 type E6, E7 gene fragment cloning, sequence analysis and in vitro transcription
[0046] Extract the genomic DNA from the disease sample, and amplify the HPV16 type E6 and E7 genes (296bp-477bp length range) by PCR, and the HPV16 type E6 and E7ORF primer sequences (5'-3') with the T7RNAPolyase promoter (underlined part): HPV16E6 gene upstream primer TAATACGACTCACTATAGGG ATGCACCAAAAGAGAACTGCAATGTTTCAG, HPV16E6 gene downstream primer TTACAGCTGGGTTTCTCTACGTGTTCTTG; HPV16E7 gene upstream primer TAATACGACTCACTATAGGG ATGCATGGAGATACACCTACATTGCAT, HPV16E7 gene downstream primer TTATGGTTTCTGAGAACAGATGGGGCACAC.
[0047] PCR reaction system: a single reaction contains 2.5uL10×PCRBuffer, 1uL2.5mMeachdNTPMix, 2uL25mMMgCl 2 , 0.4uLTaq polymerase (5U / μL), 1uLSenseprimer...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 