Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of hpv nucleic acid detection kit and its application based on enzyme-linked immunoassay

An enzyme-linked immunoassay and detection kit technology, which is applied in the fields of immunology, nucleic acid chemistry, and molecular biology, can solve the problems of complex operation, difficulty, and high cost, and achieve the effect of no need for amplification and detection equipment and low cost

Inactive Publication Date: 2016-03-30
NANJING UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The problem to be solved in the present invention: for the deficiencies of the existing HPV nucleic acid detection methods, such as relatively complicated operation and high cost caused by difficulties, corresponding amplification and detection instruments are required, and the initial viral load cannot be truly reflected. quantity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of hpv nucleic acid detection kit and its application based on enzyme-linked immunoassay
  • A kind of hpv nucleic acid detection kit and its application based on enzyme-linked immunoassay
  • A kind of hpv nucleic acid detection kit and its application based on enzyme-linked immunoassay

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0044] Specific embodiments are provided below to further illustrate the technical solutions of the present invention, but the application of the technology of the present invention is not limited to the embodiments.

[0045] 1HPV16 type E6, E7 gene fragment cloning, sequence analysis and in vitro transcription

[0046] Extract the genomic DNA from the disease sample, and amplify the HPV16 type E6 and E7 genes (296bp-477bp length range) by PCR, and the HPV16 type E6 and E7ORF primer sequences (5'-3') with the T7RNAPolyase promoter (underlined part): HPV16E6 gene upstream primer TAATACGACTCACTATAGGG ATGCACCAAAAGAGAACTGCAATGTTTCAG, HPV16E6 gene downstream primer TTACAGCTGGGTTTCTCTACGTGTTCTTG; HPV16E7 gene upstream primer TAATACGACTCACTATAGGG ATGCATGGAGATACACCTACATTGCAT, HPV16E7 gene downstream primer TTATGGTTTCTGAGAACAGATGGGGCACAC.

[0047] PCR reaction system: a single reaction contains 2.5uL10×PCRBuffer, 1uL2.5mMeachdNTPMix, 2uL25mMMgCl 2 , 0.4uLTaq polymerase (5U / μL), 1uLSenseprimer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical fields of molecular biology, immunology and nucleic acid chemistry, and particularly relates to an HPV nucleic acid detection kit based on enzyme-linked immunosorbent assay and application of the HPV nucleic acid detection kit. The kit is based on an immunoassay method for detecting high-risk HPV16 type E6 and E7 RNA by using an Sdr monoclonal antibody; a detection process is realized as follows: amplification of a target sequence by using technologies such as inverse transcription and PCR is not needed, an unlabelled DNA probe is used for being hybridized with the HPV16 type E6 and E7 RNA to form a DNA:RNA heterozygote, and then the heterozygote is recognized by using the Sdr monoclonal antibody, and subsequent signal multiplication is performed. A detection method has the advantages of high speed, low cost, high sensitivity, and no need of complicated amplification and detection instruments, and is capable of detecting an initial viral load.

Description

Technical field [0001] The invention belongs to the technical fields of molecular biology, immunology and nucleic acid chemistry. Specifically, it relates to an HPV nucleic acid detection kit based on enzyme-linked immunoassay and its application. Background technique [0002] Human papillomavirus (hereinafter referred to as HPV) is a circular double-stranded DNA virus, belonging to the family of papillomaviruses and the genus of alpha papillomavirus. Since it was first discovered in the 1970s, more than 100 HPV genotypes have been published. Some of these genotypes have been confirmed to be related to a variety of malignant lesions of epithelial or mucosal tissues, especially cervical cancer. Among women in the world, cervical cancer is a ubiquitous malignant tumor second only to breast cancer. In the United States, 12,000 women are diagnosed with cervical cancer each year. It has been recognized that HPV is the cause of almost all cervical cancers in the world. HPV causes ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/577G01N33/569G01N33/535
CPCC12Q1/6804C12Q1/70C12Q2527/143C12Q2527/101C12Q2527/125
Inventor 沈萍萍丁森卢彦
Owner NANJING UNIV