HO/LL canola with resistance to clubroot disease

A technology for clubroot and canola, which is applied in the field of HO/LL canola that is resistant to clubroot, can solve problems such as hindering breeding, troublesome and time-consuming

Active Publication Date: 2014-12-03
CORTEVA AGRISCIENCE LLC
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This already cumbersome and time-consuming approach is further accompanied by current regulatory restrictions on the transport of clubroot pathogens or any infectious material.
The foregoing considerations make screening breeding material for clubroot resistance very costly and also significantly hinder breeding efforts by limiting the number of lines that can be tested simultaneously

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HO/LL canola with resistance to clubroot disease
  • HO/LL canola with resistance to clubroot disease
  • HO/LL canola with resistance to clubroot disease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0136] Example 1: Materials and methods

[0137] plant material

[0138] Brassica varieties DMS100 (mutant type) and Quantum (wild type) were used in this study to clone the fad2 (fatty acid desaturase-2) and fad3 (fatty acid desaturase-3) alleles. DMS100 is a HO / LL (high oleic and low linolenic) line with an oleic acid content of about 77% and a linolenic acid content of about 3%. DMS100 is a single F derived from a sister line cross of Global x AG019 3 F for plant selection 4 Batch derivation. Quantum is a commercial variety and contains low oleic acid (-66%) and high linolenic acid (-7%) content. Double haploid (DH) populations through F to crosses between Brassica lines Quantum and DMS100 1 Formation of microspore cultures of plants. The DH population consisted of 604 lines. Complete fatty acid analysis of the seeds of the DH line and its parents was performed by using gas chromatography. Among the 604 DH lines, 183 were randomly selected for marker analysis and ma...

Embodiment 2

[0149] Example 2: Cloning of fad2 and fad3 alleles

[0150] Genomic DNA fragments of the fad2 gene from the parental Brassica napus line DMS100 (mutant) and Quantum (wild type) were amplified by using primers homologous to the Arabidopsis or Brassica fad2 gene sequence. et al. (1998), see Figure 1 above. The fad2 fragment amplified from each parent by primers FAD2-2F and FAD2-6R was cloned and sequenced. This primer pair amplified fad2 fragments of the same length (986bp) from each of the two parents. The sequences of these two primers are:

[0151] FAD2-2F: CAATCCCTCGCTCTTTTCTCCTACC (SEQ ID NO: 1)

[0152] FAD2-6R: CCTTTCTTGTCACCTTCCCCTGTCC (SEQ ID NO: 2)

[0153] A single nucleotide substitution mutation was identified at position 411 of the fad2 gene between the two parental lines. figure 1. The wild-type Quantum fad2 gene contains a "C" nucleotide at position 411. However, the HO / LL DMS100fad2 gene contained the SNP at the same position, where the nucleotide was ch...

Embodiment 3

[0158] Example 3: Mutant allele-specific SNP markers of fad2 and fad3 genes

[0159] Single nucleotide mutations present in the fad2 and fad3 genes were used as SNP markers to mark the fad2 and fad3 genes for selection of high C18:1 and low C18:3 in canola breeding. Mutant-specific primers (FAD2GM: CGCACCGTGATGGTTAACGGTTT (SEQ ID NO: 5); and FAD3cGM: ATAAATAATGTTGATCTACTTAT (SEQ ID NO: 15)) were designed to detect mutant alleles of fad2 and fad32 using PCR amplification. Primers were designed such that the mutated base (SNP) was at the 3' end of one primer for allele-specific PCR amplification. Figures 1 and 3.

[0160] Primers specific for fad2 amplified polymorphic bands that were present in DMS100 and DNA bulks (for high oleic acid (C18:1)), but not in Quantum and DNA bulks (for low oleic acid). Figure 4 . This gene-specific marker was tested on the DH population derived from the cross of Quantum and DMS100, where it was found that the allelic distribution was highly c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This disclosure concerns a plant of the genus, Brassica, or parts thereof, which comprise one or more traits selected from the group consisting of high oleic acid content, low linolenic acid content, increased herbicide resistance, restorer of cytoplasmic male sterility, and increased clubroot disease (Plasmodiophora brassicae) resistance, compared to a wild-type plant of the same species. This disclosure further relates to wild-type and mutant alleles of genes involved in these traits, molecular markers linked thereto, and methods of their use.

Description

[0001] priority claim [0002] This application claims priority to US Patent Application Serial No. 13 / 246,757, filed September 27, 2011. field of invention [0003] The present disclosure relates to plants that are resistant to diseases, such as Brassica napus plants that are resistant to the disease, clubroot. The present disclosure also relates to molecular markers linked to clubroot disease resistance. In particular embodiments, the disclosure relates to compositions and methods for introducing clubroot resistance into plants by, for example, using molecular markers linked to clubroot resistance. Particular embodiments relate to methods of using specific nucleic acid sequences to identify plants likely to have a clubroot resistance phenotype. Background of the invention [0004] Clubroot is a widespread disease that causes serious problems in many Brassica growing areas. See eg Dixon (1999) Grower April 29:28-9. The disease is caused by Plasmodiophora brassicae, a si...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/29A01H5/00C12N15/82A01H5/10
CPCC12N15/8279C12N9/0083C12N9/001A01H5/10A01H1/04C12N15/8282A23D9/00C12Y114/99C12Y103/01035A01H1/02C12Q1/6895C12N15/8247C12Q2600/13C12Q2600/156A01H6/202A01H1/045C12N15/00C12N15/11
InventorG.R.金格拉J.赵V.L.里普雷L.尤巴亚塞纳
OwnerCORTEVA AGRISCIENCE LLC