Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of microRNA-29a in preparing medicine for inhibiting glioma invasion and metastasis

A 1.microRNA-29a, glioma technology, applied in the field of biomedical materials, can solve the problems of increased mortality, shortened patient course, and difficult early detection of gliomas

Inactive Publication Date: 2015-01-28
NANJING UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the incidence of glioma in my country is increasing year by year, but the curative effect of conventional surgical treatment and radiotherapy and chemotherapy is not satisfactory, and the course of disease is shortened and the mortality rate of patients increases with the increase of pathological grade
In addition, gliomas are not easy to detect early, and the time from the onset of symptoms to seeing a doctor is generally several months or even years.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of microRNA-29a in preparing medicine for inhibiting glioma invasion and metastasis
  • Application of microRNA-29a in preparing medicine for inhibiting glioma invasion and metastasis
  • Application of microRNA-29a in preparing medicine for inhibiting glioma invasion and metastasis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Correlation between the expression of microRNA-29 family in clinical serum samples and the pathogenesis of glioma

[0023] 1. Material and Specimen Collection Description

[0024] Serum samples from patients with glioma were collected from clinical glioma patients at different stages, a total of 83 cases. Serum samples from normal people were collected from normal healthy people, a total of 69 cases. The diagnosis of glioma is confirmed by histopathology or magnetic resonance imaging, and the standard is based on the WHO classification; the staging of glioma is based on the classification standards of WHO and TNM (Sobin LH, Fleming ID, 1997.TNM classification of malignant tumors, fifth edition (1997). Union internationale contre le cancer and the American joint committee on cancer. Cancer 80(9):1803–1804). Patients with glioma had not undergone any anti-tumor treatment such as surgery, chemotherapy or radiotherapy before blood sampling. A total of 10 ml of ...

Embodiment 2

[0039] Example 2 Effect of microRNA-29a on the proliferation of glioma cells

[0040] The cell proliferation ability was detected by MTT method, and the screened cell lines were human glioma cell lines U87, U251, U373, A172, SHG44, U118 and U138.

[0041] The control group was transfected with random sequence miR-NC (Negative Control, NC), and the experimental group was transfected with microRNA-29a mimics (microRNA-29a mimics). The microRNA-29a mimics and random sequences were designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. (the microRNA-29a mimics sequence is "UAGCACCAUCUGAAAUCGGUUA").

[0042] (1) Cell inoculation: the human glioma cell lines U87, U251, U373, A172, SHG44, U118 and U138 in the logarithmic growth phase are formulated with DMEM medium containing 10% (v / v) fetal bovine serum A single cell suspension was inoculated into a 96-well cell culture plate at 6000 cells per well, with a volume of 100 μL per well.

[0043] (2) Cell culture and trans...

Embodiment 3

[0051] Example 3 Flow cytometric detection of the effect of microRNA-29a on apoptosis of glioma cells

[0052] The cell lines are human glioma cell lines U87, U251, U373, A172, SHG44, U118 and U138.

[0053] The control group was transfected with random sequence miR-NC (Negative Control, NC), and the experimental group was transfected with microRNA-29a mimics (microRNA-29a mimics). The microRNA-29a mimics and random sequences were designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. (the microRNA-29a mimics sequence is "UAGCACCAUCUGAAAUCGGUUA").

[0054] (1) 50nmol microRNA-29a mimics and NC were transfected in human glioma cells respectively (the transfection method was the same as in Example 2), and the medium was changed after 6 hours.

[0055] (2) After 48 hours of transfection, the cells were digested with trypsin and resuspended with PBS (0.01M, pH 7.4) pre-cooled on ice. Let stand in the dark for 10 minutes.

[0056] (3) Apoptosis was detected by flow ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of microRNA-29a in preparing a medicine for inhibiting glioma invasion and metastasis. The transwell experiment shows that microRNA-29a can effectively inhibit glioma invasion and metastasis. The result shows that microRNA-29a can be used for preparing the medicine for inhibiting glioma invasion and metastasis. The application provides a novel direction for treatment on glioma.

Description

technical field [0001] The invention belongs to the technical field of biomedical materials, and in particular relates to the application of microRNA-29a in the preparation of drugs for inhibiting the invasion and metastasis of neuroglioma. Background technique [0002] Glioma, also known as glioma for short, is the most common primary central nervous system tumor, accounting for about half of all primary intracranial tumors. In a broad sense, it refers to all neuroepithelial-derived tumors. In a narrow sense, it refers to tumors derived from various types of glial cells. According to the classification scheme of the World Health Organization (WHO) in 1999, it is divided into astrocytoma, oligobranchoma, ependymoma, mixed glioma, choroid plexus tumor, neuroepithelial tumor of uncertain origin, and neuroepithelial tumor. Neuronal and neuronal glioma, pineal parenchymal tumor, embryonal tumor, neuroblastoma tumor. Glioma is the most common intracranial tumor, accounting for ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61P35/00A61P35/04
Inventor 吴俊华江春平
Owner NANJING UNIV