Application of microRNA-29a in preparing medicine for inhibiting glioma invasion and metastasis
A 1.microRNA-29a, glioma technology, applied in the field of biomedical materials, can solve the problems of increased mortality, shortened patient course, and difficult early detection of gliomas
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1 Correlation between the expression of microRNA-29 family in clinical serum samples and the pathogenesis of glioma
[0023] 1. Material and Specimen Collection Description
[0024] Serum samples from patients with glioma were collected from clinical glioma patients at different stages, a total of 83 cases. Serum samples from normal people were collected from normal healthy people, a total of 69 cases. The diagnosis of glioma is confirmed by histopathology or magnetic resonance imaging, and the standard is based on the WHO classification; the staging of glioma is based on the classification standards of WHO and TNM (Sobin LH, Fleming ID, 1997.TNM classification of malignant tumors, fifth edition (1997). Union internationale contre le cancer and the American joint committee on cancer. Cancer 80(9):1803–1804). Patients with glioma had not undergone any anti-tumor treatment such as surgery, chemotherapy or radiotherapy before blood sampling. A total of 10 ml of ...
Embodiment 2
[0039] Example 2 Effect of microRNA-29a on the proliferation of glioma cells
[0040] The cell proliferation ability was detected by MTT method, and the screened cell lines were human glioma cell lines U87, U251, U373, A172, SHG44, U118 and U138.
[0041] The control group was transfected with random sequence miR-NC (Negative Control, NC), and the experimental group was transfected with microRNA-29a mimics (microRNA-29a mimics). The microRNA-29a mimics and random sequences were designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. (the microRNA-29a mimics sequence is "UAGCACCAUCUGAAAUCGGUUA").
[0042] (1) Cell inoculation: the human glioma cell lines U87, U251, U373, A172, SHG44, U118 and U138 in the logarithmic growth phase are formulated with DMEM medium containing 10% (v / v) fetal bovine serum A single cell suspension was inoculated into a 96-well cell culture plate at 6000 cells per well, with a volume of 100 μL per well.
[0043] (2) Cell culture and trans...
Embodiment 3
[0051] Example 3 Flow cytometric detection of the effect of microRNA-29a on apoptosis of glioma cells
[0052] The cell lines are human glioma cell lines U87, U251, U373, A172, SHG44, U118 and U138.
[0053] The control group was transfected with random sequence miR-NC (Negative Control, NC), and the experimental group was transfected with microRNA-29a mimics (microRNA-29a mimics). The microRNA-29a mimics and random sequences were designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. (the microRNA-29a mimics sequence is "UAGCACCAUCUGAAAUCGGUUA").
[0054] (1) 50nmol microRNA-29a mimics and NC were transfected in human glioma cells respectively (the transfection method was the same as in Example 2), and the medium was changed after 6 hours.
[0055] (2) After 48 hours of transfection, the cells were digested with trypsin and resuspended with PBS (0.01M, pH 7.4) pre-cooled on ice. Let stand in the dark for 10 minutes.
[0056] (3) Apoptosis was detected by flow ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 