Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for establishing recombinant yeast for biologically synthesizing glucuronic acid

A yeast and yeast technology, applied in the field of metabolic engineering, can solve the problem of not being able to generate glucuronic acid, etc., and achieve the effects of cheap culture medium, fast growth and high expression level

Inactive Publication Date: 2015-01-28
JIANGNAN UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] At present, no report has been found to ferment and produce glucuronic acid by recombinant yeast. The original yeast strain cannot produce glucuronic acid. In view of this, the novel recombinant engineering bacteria constructed in the present invention provide new methods and ideas

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for establishing recombinant yeast for biologically synthesizing glucuronic acid
  • Method for establishing recombinant yeast for biologically synthesizing glucuronic acid
  • Method for establishing recombinant yeast for biologically synthesizing glucuronic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Construction of recombinant yeast Pichia pastoris GS115 / pGAPZB-MIOX

[0040] Using Pichia pastoris GS115 genome as template, PCR amplified MIOX gene

[0041] Primers F (sequence shown in SEQ ID NO.3) and R (sequence shown in SEQ ID NO.4) are as follows, wherein the underlined part is the primer restriction site:

[0042] F: CCG CTCGAG ATGTCAGTACAAAAAAAGCACGAAG

[0043] R: TGC TCTAGA TCAAAACTTTACCAGCTTTTGAGG

[0044]The amplified inositol oxygenase gene was digested with XhoI and XbaI, connected to an expression vector with corresponding cuts (carrier pGAPZB was digested with XhoI and XbaI), transformed into E.coil Top10, and ensured that The recombinant expression plasmid pGAPZB-MIOX was identified under the correct reading frame, and the recombinant sequence was correct after DNA sequencing and comparison. The recombinant plasmid was linearized by BspHI and then electroporated into the expression host Pichia pastoris GS115. The recombinant clone was ve...

Embodiment 2

[0045] Example 2 Construction of recombinant yeast Pichia pastoris GS115 / pPIC9K-GAP-MIOX

[0046] Use the pGAPZB plasmid as a template to amplify the GAP promoter by PCR. The primers are F1 (sequence shown in SEQ ID NO.5), R1 (sequence shown in SEQ ID NO.6), and the underlined part is the restriction site

[0047] F1: C GAGCT CAGATCTTTTTTGTAGAAATGTCTTG

[0048] R1: CTTCGTGCTTTTTTGTACTGACATCGTTTCGAAATAGTTGTTCAATT

[0049] Using the Pichia pastoris GS115 genome as a template to amplify the MIOX gene, the primers are F2 (sequence shown in SEQ ID NO.7), R2 (sequence shown in SEQ ID NO.8) as follows, and the shaded part is Restriction sites

[0050] F2: AATTGAACAACTATTTCGAAACGATGTCAGTACAAAAAAAGCACGAAG

[0051] R2: ATAAGAAT GCGGCCGC TCAAAACTTTACCAGCTTTTGAGG

[0052] Using the method of fusion PCR, the GAP promoter was fused with the MIOX gene, and restriction sites Sacl and Notl were introduced at both ends of the fusion fragment, and the fusion fragment was double digested ...

Embodiment 3

[0053] Example 3 Recombinant Pichia pastoris produces glucuronic acid by fermentation

[0054] The recombinant Pichia pastoris GS115 / pPIC9K-GAP-MIOX clone was used for fermentation. The single clone was inoculated in 25ml of YPD medium (yeast extract 10g / L, peptone 20g / L, glucose 20g / L), and cultured at 30°C and 200rpm for 24h. Inoculate 10% of the inoculum into 50ml (the capacity of the shaker flask is 500ml) fermentation medium for fermentation, and cultivate for 60 hours. The fermentation medium is divided into YPD medium and YPD-MI medium (60 mM inositol is added to YPD medium). After the cultivation, 1ml of the fermentation broth was centrifuged at 8000rpm for 10min, the supernatant was filtered through a 0.22um filter membrane, and the product was detected by LC-MS. figure 2 It is the LC-MS detection result of the product glucuronic acid, A is the standard sample of glucuronic acid, B is the fermentation liquid of the recombinant strain, and the [M-1] of glucuronic ac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for establishing recombinant yeast for biologically synthesizing glucuronic acid, belonging to the field of metabolic engineering. According to the method, inositol oxygenase genes (MIOX) of different resources are expressed in different yeast hosts, and biological synthesis of glucuronic acid is achieved by taking glucose or inositol as a substrate. 20mg / L of glucuronic acid is generated from a recombinant pichia pastoris strain in a YPD fermentation culture medium, and 50mg / L of pichia pastoris is generated from a YPD-MI (60mM of inositol is added into the YPD culture medium) fermentation culture medium. The method for establishing recombinant yeast for synthesizing glucuronic acid has wide development prospect, and a novel idea is provided for synthesizing glucuronic acid by using a biological method.

Description

technical field [0001] The invention relates to a method for constructing recombinant yeast to biosynthesize glucuronic acid, which belongs to the field of metabolic engineering. Background technique [0002] Glucuronic acid, the full name of D-(+)-glucuronic acid (D-glucuronic acid), is a compound formed by oxidation of the primary alcoholic hydroxyl group of glucose into a carboxyl group. Its aqueous solution is unstable and easily converted into 3,6-glucuronic acid Lactone, the two are in a state of interconverting equilibrium in aqueous solution. When glucuronic acid is heated and strong acid exists, it is easy to decarboxylate and produce CO2, furan and other products. [0003] Glucuronic acid widely exists in animals and plants and has important biological functions. It can combine toxic substances containing hydroxyl, amino, carboxyl, sulfhydryl and other groups, enhance the water solubility of toxic substances, make them quickly excreted from the kidneys, and play ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/81C12P19/02C12R1/865C12R1/84C12R1/73
CPCC12N9/0069C12P19/02C12Y113/99001
Inventor 康振陈坚堵国成王淼刘叶
Owner JIANGNAN UNIV