Method for establishing recombinant yeast for biologically synthesizing glucuronic acid
A yeast and yeast technology, applied in the field of metabolic engineering, can solve the problem of not being able to generate glucuronic acid, etc., and achieve the effects of cheap culture medium, fast growth and high expression level
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 Construction of recombinant yeast Pichia pastoris GS115 / pGAPZB-MIOX
[0040] Using Pichia pastoris GS115 genome as template, PCR amplified MIOX gene
[0041] Primers F (sequence shown in SEQ ID NO.3) and R (sequence shown in SEQ ID NO.4) are as follows, wherein the underlined part is the primer restriction site:
[0042] F: CCG CTCGAG ATGTCAGTACAAAAAAAGCACGAAG
[0043] R: TGC TCTAGA TCAAAACTTTACCAGCTTTTGAGG
[0044]The amplified inositol oxygenase gene was digested with XhoI and XbaI, connected to an expression vector with corresponding cuts (carrier pGAPZB was digested with XhoI and XbaI), transformed into E.coil Top10, and ensured that The recombinant expression plasmid pGAPZB-MIOX was identified under the correct reading frame, and the recombinant sequence was correct after DNA sequencing and comparison. The recombinant plasmid was linearized by BspHI and then electroporated into the expression host Pichia pastoris GS115. The recombinant clone was ve...
Embodiment 2
[0045] Example 2 Construction of recombinant yeast Pichia pastoris GS115 / pPIC9K-GAP-MIOX
[0046] Use the pGAPZB plasmid as a template to amplify the GAP promoter by PCR. The primers are F1 (sequence shown in SEQ ID NO.5), R1 (sequence shown in SEQ ID NO.6), and the underlined part is the restriction site
[0047] F1: C GAGCT CAGATCTTTTTTGTAGAAATGTCTTG
[0048] R1: CTTCGTGCTTTTTTGTACTGACATCGTTTCGAAATAGTTGTTCAATT
[0049] Using the Pichia pastoris GS115 genome as a template to amplify the MIOX gene, the primers are F2 (sequence shown in SEQ ID NO.7), R2 (sequence shown in SEQ ID NO.8) as follows, and the shaded part is Restriction sites
[0050] F2: AATTGAACAACTATTTCGAAACGATGTCAGTACAAAAAAAGCACGAAG
[0051] R2: ATAAGAAT GCGGCCGC TCAAAACTTTACCAGCTTTTGAGG
[0052] Using the method of fusion PCR, the GAP promoter was fused with the MIOX gene, and restriction sites Sacl and Notl were introduced at both ends of the fusion fragment, and the fusion fragment was double digested ...
Embodiment 3
[0053] Example 3 Recombinant Pichia pastoris produces glucuronic acid by fermentation
[0054] The recombinant Pichia pastoris GS115 / pPIC9K-GAP-MIOX clone was used for fermentation. The single clone was inoculated in 25ml of YPD medium (yeast extract 10g / L, peptone 20g / L, glucose 20g / L), and cultured at 30°C and 200rpm for 24h. Inoculate 10% of the inoculum into 50ml (the capacity of the shaker flask is 500ml) fermentation medium for fermentation, and cultivate for 60 hours. The fermentation medium is divided into YPD medium and YPD-MI medium (60 mM inositol is added to YPD medium). After the cultivation, 1ml of the fermentation broth was centrifuged at 8000rpm for 10min, the supernatant was filtered through a 0.22um filter membrane, and the product was detected by LC-MS. figure 2 It is the LC-MS detection result of the product glucuronic acid, A is the standard sample of glucuronic acid, B is the fermentation liquid of the recombinant strain, and the [M-1] of glucuronic ac...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 