Unlock instant, AI-driven research and patent intelligence for your innovation.

Indel marker of cucumber resistance gene prsv to papaya ring spot virus disease and its application

A technology of ringspot virus and papaya, applied in the direction of DNA / RNA fragments, recombinant DNA technology, etc., can solve problems such as long distances

Active Publication Date: 2017-04-05
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The currently reported genetic linkage markers related to PRSV resistance include AFLP and RAPD markers, but these markers are far from the resistance gene linkage and have not been located on the chromosome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Indel marker of cucumber resistance gene prsv to papaya ring spot virus disease and its application
  • Indel marker of cucumber resistance gene prsv to papaya ring spot virus disease and its application
  • Indel marker of cucumber resistance gene prsv to papaya ring spot virus disease and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1. Acquisition of the prsvIndel2 marker linked to the cucumber anti-PRSV gene prsv

[0035] Step 1. Identification of Cucumber PRSV Seedling Stage Resistance

[0036]In this experiment, high-generation cucumber inbred lines 65G (susceptible) and 02245 (disease-resistant) were used as female and male parents, and F1, F2 populations and F2:3 families were obtained by selfing. In the autumn of 2013, in the artificial climate room of the Pathology Research Group of the Vegetable and Flower Research Institute of the Chinese Academy of Agricultural Sciences, artificial friction inoculation of PRSV seedlings was carried out on F1 and 144 F2:3 families, and 15 plants were planted in each family. When the first true leaf was flattened , for inoculation identification.

[0037] 20 days after the first inoculation, the investigation was conducted. During the investigation, the disease was divided into 6 grades, namely: Grade 0, asymptomatic; Grade 1, clear veins of heart ...

Embodiment 2

[0078] Example 2. Verification of the prsvIndel2 marker linked to the cucumber prsv gene

[0079] Use the Indel marker prsvIndel2 linked to the prsv gene obtained in Example 1 to verify the parents, F1 and 123 F2 materials and 35 cucumber materials (Table 1) with different genetic backgrounds to determine that the marker is used for molecular marker-assisted selection accuracy. The verification adopts the PCR amplification and detection method in Step 2 of Example 1.

[0080] Compared with the field phenotypes of the selected materials, the prsvIndel2 marker verified 123 F2 materials, and the results showed that the phenotype data reflected by the band patterns of 113 F2 strains were consistent with the field investigation results, and the accuracy rate was 91.9% ( Part of the PAGE gel electrophoresis detection results are shown in figure 1 ).

[0081] In addition, the prsvIndel2 marker was repeatedly verified using 35 known cucumber varieties with different genetic backgro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Indel marker of a cucumber anti-papaya ringspot virus prsv gene and application of the Indel marker and relates to the field of biotechnology-assisted breeding. The Indel marker which is closely linked with a cucumber papaya ringspot virus (PRSV) resistance gene prsv is characterized by prsvInde2-F / prsvInde2-R: CTTCCCCATCATCATACATC / AAGCAGGAGAATGAAACAAC; a characteristic band which is amplified by the Indel marker and is linked with a cucumber PRSV susceptibility gene PRSV is 176bp, and the nucleotide sequence is as shown in Seq ID No. 1; the characteristic band which is amplified by the Indel marker and is linked with the cucumber PRSV resistance gene prsv is 170bp, and the nucleotide sequence is as shown in Seq ID No. 2; and by adopting the Indel marker obtained according to the invention, whether a cucumber candidate material has resistance against PRSV or not can be judged in any phase, and the marker has the advantages of high efficiency and few limitations, and can improve the efficiency of breeding anti-PRSV cucumber breeding materials and shorten the breeding period.

Description

technical field [0001] The invention relates to the technical field of biotechnology-assisted breeding, in particular to an Indel marker of papaya ringspot virus-resistant gene prsv in cucumber and its application in selection of cucumber breeding materials. Background technique [0002] Virus disease is one of the main diseases affecting cucumber production. There are many kinds of pathogens and it is difficult to prevent and control. Among them, papaya ring spot virus (Papaya ring spot virus, PRSV) is a main pathogen that causes the disease. PRSV is a kind of Potatovirus Y virus mainly transmitted by aphids. Generally, it spreads faster in late summer and early autumn, because the increase in the number of aphids carrying the disease source at this time greatly increases the spread rate of the virus. Once the plant is infected with the virus disease , generally can reduce production by 10% to 20%, and severe cases can reach 40% to 50%, or even stop production, and serious...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 顾兴芳张圣平苗晗田桂丽王烨谢丙炎杨宇红
Owner INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI