A taqman Real-time PCR kit for detecting porcine pseudorabies virus
A porcine pseudorabies virus and kit technology, applied in the direction of microorganism-based methods, microorganism measurement/testing, microorganisms, etc., can solve the problems of not being able to meet the needs of rapid, sensitive, accurate and quantitative detection, and achieve high accuracy, Accurate price quantification, highly sensitive effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] 1. Design and preparation of primers:
[0035] Refer to GenBank (gene bank) to find ten strains, find the conserved regions on each sequence through sequence comparison, select the conserved regions and design a pair of amplification primers and a probe primer, the sequence is as follows:
[0036] The amplification primer sequences are:
[0037] SEQ ID NO: 1: Upstream primer CCCTGGGCGCCTCCTTCGTCA,
[0038] SEQ ID NO: 2: Downstream primer TGTTGTAGCGCCGCCGGTAGATGG.
[0039] The probe primer sequence is:
[0040] SEQ ID NO: 3: CGACGTCACGCAGCTCGACCTGCAGCG.
[0041] The above primers were synthesized and labeled by Dalian Bao Biological Engineering Co., Ltd.
[0042] Positive control: the positive control of the kit of the present invention and its standard curve were constructed and preserved by the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences.
[0043] 2. Prepare the kit:
[0044] This kit consists of the following components:...
Embodiment 2
[0056] Step 1~2 is with embodiment 1;
[0057] 3. Use the method for detecting PRV with the kit of the present invention:
[0058] (1) The total PCR system is 25 μl. Add a. 12.5 μL of 2× amplification master mix in the kit of the present invention; b. 3 μl of three primers; c. 6.5 μl of DNA / RNase-free water into a 0.2ml amplification tube;
[0059] (2) Add 3 μl of positive control, 3 μl of DNA template extracted from the pig spleen to be tested, and 3 μl of negative control to the above-mentioned amplification tubes, centrifuge at 12000 rpm for 5-30 seconds, put the amplification tubes into the amplification instrument, and Amplification was performed under the following setting program: pre-denaturation at 94°C for 2 minutes; 94°C for 20s, annealing temperature at 60°C for 30s, 72°C for 20s, 40 cycles. Directly observe the amplification results on the real-time quantitative amplification instrument.
[0060] 4. Result analysis:
[0061] Judgment based on the amplification...
Embodiment 3
[0063] Step 1~2 is with embodiment 1;
[0064] 3. Use the method for detecting PRV with the kit of the present invention:
[0065] (1) The total PCR system is 25 μl. Add a. 12.5 μL of 2× amplification master mix in the kit of the present invention; b. 3 μl of three primers; c. 6.5 μl of DNA / RNase-free water into a 0.2ml amplification tube;
[0066] (2) Add 3 μl of positive control, 3 μl of DNA template extracted from the porcine lymph node to be tested, and 3 μl of negative control to the above-mentioned amplification tube, centrifuge at 12000 rpm for 5-30 seconds, put the amplification tube into the amplification instrument, and Amplification under the following setting program: pre-denaturation at 94°C for 2 minutes; 94°C for 20s, annealing temperature at 60°C for 30s, 72°C for 20s, 40 cycles; directly observe the amplification results on the real-time quantitative amplification instrument;
[0067] 4. Result analysis:
[0068] Judgment based on the amplification results:...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap