A taqman Real-time PCR kit for detecting porcine pseudorabies virus

A porcine pseudorabies virus and kit technology, applied in the direction of microorganism-based methods, microorganism measurement/testing, microorganisms, etc., can solve the problems of not being able to meet the needs of rapid, sensitive, accurate and quantitative detection, and achieve high accuracy, Accurate price quantification, highly sensitive effects

Active Publication Date: 2016-06-29
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved by the present invention is to overcome the existing technology that cannot adapt to the fast, sensitive, accurate and quantitative detection requirements, thereby providing a kind of fast, sensitive, accurate and quantitative detection virus for detecting porcine pseudorabies virus TaqmanReal-timePCR test kit, the present invention also provides the use method of this test kit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A taqman Real-time PCR kit for detecting porcine pseudorabies virus
  • A taqman Real-time PCR kit for detecting porcine pseudorabies virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] 1. Design and preparation of primers:

[0035] Refer to GenBank (gene bank) to find ten strains, find the conserved regions on each sequence through sequence comparison, select the conserved regions and design a pair of amplification primers and a probe primer, the sequence is as follows:

[0036] The amplification primer sequences are:

[0037] SEQ ID NO: 1: Upstream primer CCCTGGGCGCCTCCTTCGTCA,

[0038] SEQ ID NO: 2: Downstream primer TGTTGTAGCGCCGCCGGTAGATGG.

[0039] The probe primer sequence is:

[0040] SEQ ID NO: 3: CGACGTCACGCAGCTCGACCTGCAGCG.

[0041] The above primers were synthesized and labeled by Dalian Bao Biological Engineering Co., Ltd.

[0042] Positive control: the positive control of the kit of the present invention and its standard curve were constructed and preserved by the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences.

[0043] 2. Prepare the kit:

[0044] This kit consists of the following components:...

Embodiment 2

[0056] Step 1~2 is with embodiment 1;

[0057] 3. Use the method for detecting PRV with the kit of the present invention:

[0058] (1) The total PCR system is 25 μl. Add a. 12.5 μL of 2× amplification master mix in the kit of the present invention; b. 3 μl of three primers; c. 6.5 μl of DNA / RNase-free water into a 0.2ml amplification tube;

[0059] (2) Add 3 μl of positive control, 3 μl of DNA template extracted from the pig spleen to be tested, and 3 μl of negative control to the above-mentioned amplification tubes, centrifuge at 12000 rpm for 5-30 seconds, put the amplification tubes into the amplification instrument, and Amplification was performed under the following setting program: pre-denaturation at 94°C for 2 minutes; 94°C for 20s, annealing temperature at 60°C for 30s, 72°C for 20s, 40 cycles. Directly observe the amplification results on the real-time quantitative amplification instrument.

[0060] 4. Result analysis:

[0061] Judgment based on the amplification...

Embodiment 3

[0063] Step 1~2 is with embodiment 1;

[0064] 3. Use the method for detecting PRV with the kit of the present invention:

[0065] (1) The total PCR system is 25 μl. Add a. 12.5 μL of 2× amplification master mix in the kit of the present invention; b. 3 μl of three primers; c. 6.5 μl of DNA / RNase-free water into a 0.2ml amplification tube;

[0066] (2) Add 3 μl of positive control, 3 μl of DNA template extracted from the porcine lymph node to be tested, and 3 μl of negative control to the above-mentioned amplification tube, centrifuge at 12000 rpm for 5-30 seconds, put the amplification tube into the amplification instrument, and Amplification under the following setting program: pre-denaturation at 94°C for 2 minutes; 94°C for 20s, annealing temperature at 60°C for 30s, 72°C for 20s, 40 cycles; directly observe the amplification results on the real-time quantitative amplification instrument;

[0067] 4. Result analysis:

[0068] Judgment based on the amplification results:...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a Taqman Real-time PCR kit for detecting porcine pseudorabies virus. The Taqman Real-time PCR kit comprises an amplification premixed liquid, a negative control, a positive control and a mixture of amplification primers having sequences as shown in SEQIDNO: 1 and SEQIDNO: 2 and a probe primer having a sequence as shown in SEQIDNO: 3. According to the kit, the change in the amount of amplified products in each cycle of the PCR amplification reaction is detected in real time by the change in fluorescence signals, the starting template is subjected to quantitative analysis by the relationship between Ct values and a standard curve and thus the copy number of the to-be-detected sample is calculated, the results are more accurate and intuitive, both time and labor are saved, the cost is relatively low and the detection time is shortened from original 3-4 hours to 1-2 hours; the kit has higher sensitivity than conventional PCR and can be used for detection of the sample having low or trace content of porcine pseudorabies virus and suitable for quantitative analysis in research institutes as well as pathogen detection and analysis in all levels of prevention and control units, primary veterinary stations, and large-sized and medium-sized farms and the like and has good application prospects.

Description

technical field [0001] The invention relates to the technical field of porcine pseudorabies virus prevention and control, specifically a Taqman Real-time PCR (probe method real-time-quantitative polymerase chain reaction) kit for detecting porcine pseudorabies virus, and the present invention also includes the components of the kit Instructions. Background technique [0002] Pseudorabies virus (PRV) is a herpes virus that can infect a variety of domestic animals and wild animals. Pigs are the storage host and source of infection of the virus. The virus can cause reproductive disorders in sows and mass deaths of newborn piglets; adult pigs Recessive infection occurs, and long-term poisoning and detoxification seriously affect the production of breeding pig farms and the promotion of fine varieties, causing great losses to the pig industry. The domestic diagnostic methods for porcine pseudorabies mainly include virus isolation and identification and serological diagnosis meth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/6851C12Q1/70C12Q2531/113C12Q2561/101C12Q2561/113
Inventor 刘湘涛吴锦艳田宏陈妍尚佑军
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap