Target sequence for detecting mycoplasma pneumoniae and detection kit

A Mycoplasma pneumoniae and target sequence technology, applied in the field of molecular biology, can solve problems such as the difficulty of designing probe primers

Active Publication Date: 2015-04-29
ICDC CHINA CDC
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, there are great difficulties in finding conserved and stabl

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Target sequence for detecting mycoplasma pneumoniae and detection kit
  • Target sequence for detecting mycoplasma pneumoniae and detection kit
  • Target sequence for detecting mycoplasma pneumoniae and detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Screening and Determination of Specific Repeated Sequences for Detection of Mycoplasma pneumoniae

[0036] Select 20 domestic clinical isolates of Mycoplasma pneumoniae of different types for enrichment culture, and extract the DNA of the whole bacteria. After the concentration measurement, use the Illumina Hiseq 2000 sequencer to perform whole genome sequencing, and obtain the drafts of the whole genome of 20 strains of Mycoplasma pneumoniae. The sequenced strains were compared with the known RepMP repeat sequences in the NCBI database using Vector NTI Suite 6 software to find out the conserved regions. A 92bp nucleotide conservation region in the RepMP23 repeat sequence was found, and its nucleotide sequence is shown in SEQ ID NO.1, which corresponds to nt170-261 in the RepMP23-a sequence and corresponds to nt161- in the RepMP23-b sequence 252, corresponding to nt468-559 in the RepMP23-d sequence, corresponding to nt177-268 in the RepMP23-e sequence, corresp...

Embodiment 2

[0037] Example 2 Primers and probes for detecting specific repeat sequences of Mycoplasma pneumoniae

[0038] For the target sequence used to amplify Mycoplasma pneumoniae determined in Example 1, the inventor designed many sets of primer and probe combinations. Through experimental comparison, it was found that the fluorescence signal value of the following primer and probe combinations exceeded 11,000, and the annealing temperature was 55 The detection ct value between ℃-59 ℃ is the smallest, so the present invention determines that the combination of primers and probes is the best combination for fluorescent quantitative PCR detection of Mycoplasma pneumoniae.

[0039] RepMP23-F1:GTG(G / A)ATGATATAACCGCGCC (SEQ ID NO.2)

[0040] RepMP23-R1:GAACGCGAACCACTTGTGTTC (SEQ ID NO.3)

[0041] RepMP23-MGB-P1:FAM-TCGTCCAGCGGAAC-BHQ1 (SEQ ID NO.4)

Embodiment 3

[0042] Example 3 Optimization of Experimental Parameters and Method Establishment for Detection of Mycoplasma pneumoniae by Real-time Fluorescent Quantitative PCR

[0043] (1) Optimization of magnesium ion concentration in the system: MgCl in the system 2 Increase from 0.5 μl to 4 μl successively, each increment of 0.5 μl, and make 3 parallel samples for each concentration gradient. ResultMgCl 2 The amount added is 1 μl (MgCl 2 When the final concentration is 3mM), the amplification effect of the system is the best.

[0044] (2) Optimization of the annealing temperature of the system: the annealing temperature of the system was changed from 55°C to 65°C, and the results showed that the amplification effect of the system was the best when the annealing temperature was 56-59°C.

[0045] (3) Optimization of MpP1 real-time fluorescent quantitative PCR amplification system and amplification conditions

[0046]

[0047] Amplification conditions: pre-denaturation at 95°C for 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a target sequence for detecting mycoplasma pneumoniae and a detection kit. According to the target sequence, genes of the mycoplasma pneumonia are firstly sequenced and compared and are then screened to obtain multi-copy repeated-sequence genes for detecting the mycoplasma pneumonia, and the sequence of the target sequence is represented by SEQ ID NO.1; a real-time fluorescence quantitative PCR primer and a probe for detecting the target sequence are designed, and the nucleotide sequences of the real-time fluorescence quantitative PCR primer and the probe are respectively represented by SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4. According to the detection kit, the sensitivity for detecting the mycoplasma pneumonia can be as low as 0.2CFU; the detection kit has no nonspecific amplification to clinically common 23 respiratory pathogens, presents good specificity and has the advantages that the detection is accurate, easy, convenient and rapid, the sensitivity is high, the specificity is strong, and the sample detection capacity is good.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a target sequence for detecting mycoplasma pneumoniae, a fluorescent quantitative PCR primer and a probe, and also relates to a method and a kit for detecting mycoplasma pneumoniae by using the target sequence. Background technique [0002] Mycoplasma pneumoniae (Mycoplasma pneumoniae) is one of the important pathogens causing human respiratory tract infection, and about 10%-40% of community-acquired pneumonia is caused by its infection every year. Due to the lack of rapid and sensitive detection technology and detection kits, the current domestic clinical diagnosis of Mycoplasma pneumoniae is limited, and misdiagnosis and missed diagnosis are common, which has brought negative effects on medical burden and doctor-patient relationship. At present, fluorescent PCR detection technology is more and more widely used in clinical detection of Mycoplasma pneumoniae infection due to its ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/35
CPCC12Q1/689
Inventor 赵飞张建中何利华孟凡亮顾一心陶晓霞肖迪张慧芳胡源刘立雍
Owner ICDC CHINA CDC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap