Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection method for CYP4F2 gene polymorphism, as well as nucleic acid probe and kit for method

A CYP4F2, gene polymorphism technology, used in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc.

Inactive Publication Date: 2015-04-29
FUWAI HOSPITAL OF CARDIOVASCULAR DESEASE CHINESE ACAD OF MEDICAL SCI
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, CYP4F2 gene detection has been commercialized, but domestic medical institutions can only use western commercial products for warfarin sensitive gene detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method for CYP4F2 gene polymorphism, as well as nucleic acid probe and kit for method
  • Detection method for CYP4F2 gene polymorphism, as well as nucleic acid probe and kit for method
  • Detection method for CYP4F2 gene polymorphism, as well as nucleic acid probe and kit for method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0108] 1. Preparation of probes and primer pairs for CYP4F2 gene

[0109] A probe for the CYP4F2 gene and a primer pair for the CYP4F2 gene were prepared using conventional techniques.

[0110] The specific sequence is as follows:

[0111] Probe for CYP4F2 gene

[0112] CYP4F2 mutant probe C3-P-M: FAM-aacccagctAtgtggccgg-BHQ2

[0113] CYP4F2 wild-type probe C3-P-W: HEX-aacccagctGtgtggccg-BHQ2

[0114] Primer pair for CYP4F2 gene

[0115] Forward primer sequence C3-S-1: ATCAGTGTTTTCGGAACCCATC

[0116] Reverse primer sequence C3-A-1: GAGGGGCCCCGCACC

[0117] Second, configure the PCR reaction solution,

[0118] The serving size is as follows:

[0119] Commercially available 2×PCR reaction solution (including taq enzyme, UNG enzyme, dNTP, dUTP) 10 μL

[0120] Primer and probe mix 1 μL

[0121] Internal control probe mixture 1 μL

[0122] RNase-free water 7 μL

[0123]

[0124] Aliquot, 19 μl per tube into 0.1ml PCR reaction tubes / plates, and transfer to the sample p...

Embodiment 2

[0138] Steps one to four:

[0139] In the same method and steps as in Example 1, the DNA sample was replaced by a CYP4F2 mutant DNA sample, and 1 μl of the mutant DNA sample was added to 19 μl of the PCR reaction solution.

[0140] 5. Results analysis

[0141] CYP4F2 appears to be mutant as a result of Figure 2 show. These graphs are analysis graphs showing changes in fluorescence intensity over time, that is, changes in fluorescence intensity as the number of amplification cycles increases. Such as Figure 2 As shown, the fluorescence curve indicates that the CYP4F2 gene in the sample is a mutant type.

Embodiment 3

[0143] Steps one to four:

[0144] In the same method and steps as in Example 1, the DNA sample was replaced with a CYP4F2 wild-type DNA sample, and 1 μl of the wild-type DNA sample was added to 19 μl of the PCR reaction solution.

[0145] 5. Results analysis

[0146] CYP4F2 expresses wild-type results in Figure 3 show. These graphs are analysis graphs showing changes in fluorescence intensity over time, that is, changes in fluorescence intensity as the number of amplification cycles increases. Such as Figure 3 As shown, the fluorescence curve indicates that the CYP4F2 gene in the sample is wild type.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detecting probe for CYP4F2 gene polymorphism. The nucleotide sequences of the detecting probe are selected from a sequence 1 and a sequence 2; a fluorescent group and a quenching group are respectively arranged at the ends (5' and 3'); the peak values of the wavelengths of the florescent light emitted from the fluorescent group are at different positions. Preferably, the quenching group is selected from MGB and BHQ2; preferably, the fluorescent group is selected from FAM, VIC, JOE, HEX, CY3, NED, TAMRA, ROX, TEXAS RED, CY5 and the like. The invention further discloses a primer pair used for gene amplification; the primer pair comprises a forward primer and a reverse primer; the forward primer is an oligonucleotide which consists of base sequences of a sequence 3; the reverse primer is an oligonucleotide which consists of base sequences of a sequence 4. The invention further discloses a kit which contains the primers and the probe, and a detecting method for the CYP4F2 gene polymorphism.

Description

technical field [0001] The invention relates to a detection probe and amplification primer for CYP4F2 gene polymorphism, belonging to the field of biotechnology. Background technique [0002] Warfarin is an oral anticoagulant that has been widely used in the fields of thrombosis prevention in atrial fibrillation, stroke, venous thromboembolism, and antithrombotic therapy after mechanical valve implantation in recent decades. The drug is a racemic isomer, wherein the R-type enantiomer and the S-type enantiomer have different action strengths, and the pharmacological effect of the S-type is 3-6 times that of the R-type. . The drug has strong water solubility, is rapidly absorbed through the gastrointestinal tract, and has a bioavailability close to 100%. The peak plasma concentration is reached 90 minutes after oral administration, and the half-life is 36 to 42 hours. Combined with plasma protein in blood circulation (binding rate 98% ~ 99%). The two enantiomers accumulate...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888C12Q2600/106C12Q2600/156
Inventor 李一石刘红韩璐璐田蕾娄莹王巍许建屏
Owner FUWAI HOSPITAL OF CARDIOVASCULAR DESEASE CHINESE ACAD OF MEDICAL SCI