Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for detecting VKORC1 gene polymorphism and nucleic acid probe and kit used in method

A technology for gene polymorphism and detection probes, used in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc.

Inactive Publication Date: 2015-05-06
FUWAI HOSPITAL OF CARDIOVASCULAR DESEASE CHINESE ACAD OF MEDICAL SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, CYP2C9 and VKORC1 gene detection has been commercialized, but domestic medical institutions can only use western commercial products for warfarin sensitive gene detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting VKORC1 gene polymorphism and nucleic acid probe and kit used in method
  • Method for detecting VKORC1 gene polymorphism and nucleic acid probe and kit used in method
  • Method for detecting VKORC1 gene polymorphism and nucleic acid probe and kit used in method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0108] 1. Preparation of probes and primer pairs for VKORC1 gene

[0109] A probe for the VKORC1 gene and a primer pair for the VKORC1 gene were prepared using conventional techniques.

[0110] The specific sequence is as follows:

[0111] Probe for VKORC1 gene

[0112] VKORC1 mutant probe C5-P-M: FAM-ccattggccAggtgcgg-BHQ2

[0113] VKORC1 wild-type probe C5-P-W: HEX-cattggccGggtgcgg-BHQ2

[0114] Primer pair for VKORC1 gene

[0115] Forward primer sequence C5-S-1: AAGCAAGAGAAGACCTGAAAAAC

[0116] Reverse primer sequence C5-A-2: AATGCTAGGATTATAGGCGTGAG

[0117] Second, configure the PCR reaction solution,

[0118] The serving size is as follows:

[0119] Commercially available 2×PCR reaction solution (including taq enzyme, UNG enzyme, dNTP, dUTP) 10 μL

[0120] Primer and probe mix 1 μL

[0121] Internal control probe mixture 1 μL

[0122] RNase-free water 7 μL

[0123]

[0124] Aliquot, 19 μl per tube into 0.1ml PCR reaction tubes / plates, and transfer to the sam...

Embodiment 2

[0138] Steps one to four:

[0139] In the same method and steps as in Example 1, the DNA sample was replaced with a DNA sample expressing a mutant VKORC1, and 1 μl of the mutant DNA sample was added to 19 μl of the PCR reaction solution.

[0140] 5. Results analysis

[0141] VKORC1 appears to be mutant as a result of Figure 2 show. These graphs are analysis graphs showing changes in fluorescence intensity over time, that is, changes in fluorescence intensity as the number of amplification cycles increases. Such as Figure 2 As shown, the fluorescence curve indicates that the VKORC1 gene in the sample is a mutant type.

Embodiment 3

[0143] Steps one to four:

[0144] In the same method and steps as in Example 1, the DNA sample was replaced with a DNA sample expressing wild-type VKORC1, and 1 μl of the wild-type DNA sample was added to 19 μl of the PCR reaction solution.

[0145] 5. Results Analysis

[0146] VKORC1 expresses wild-type results in Figure 3 show. These graphs are analysis graphs showing changes in fluorescence intensity over time, that is, changes in fluorescence intensity as the number of amplification cycles increases. Such as Figure 3 As shown, the fluorescence curve indicates that the VKORC1 gene in the sample is wild type.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a probe for detecting VKORC1 gene polymorphism. A nucleotide sequence of the detecting probe is selected from a sequence I and a sequence 2, and respectively comprises a fluorescent group and a quenching group at 5' end and 3' end; the wavelength peak lengths of fluorescent lights emitted from the fluorescent group are at different positions; preferably, the quenching group is selected from MGB and BHQ2; preferably, the fluorescent group is selected from FAM, VIC, JOE, HEX, CY3, NED, TAMRA, ROX, TEXAS, RED, CY5 and the like. The invention further discloses a primer pair for gene amplification. The primer pair comprises a positive primer and a reverse primer, wherein the positive primer is oligonucleotides formed by a base sequence in a sequence 3; and the reverse primer is oligonucleotides formed by a base sequence in a sequence 4. The invention further discloses a kit containing the primer and the probe, and a method for detecting CYP2C9*2 gene polymorphism.

Description

technical field [0001] The invention relates to a detection probe and amplification primer for VKORC1 gene polymorphism, belonging to the field of biotechnology. Background technique [0002] Warfarin is an oral anticoagulant that has been widely used in the fields of thrombosis prevention in atrial fibrillation, stroke, venous thromboembolism, and antithrombotic therapy after mechanical valve implantation in recent decades. The drug is a racemic isomer, wherein the R-type enantiomer and the S-type enantiomer have different action strengths, and the pharmacological effect of the S-type is 3-6 times that of the R-type. The drug has strong water solubility, is rapidly absorbed through the gastrointestinal tract, and has a bioavailability close to 100%. The peak plasma concentration is reached 90 minutes after oral administration, and the half-life is 36 to 42 hours. Combined with plasma protein in blood circulation (binding rate 98% ~ 99%). The two enantiomers accumulated i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6883C12Q1/6858C12Q2600/106C12Q2600/156C12Q2561/101C12Q2563/107
Inventor 李一石刘红韩璐璐田蕾娄莹王巍许建屏
Owner FUWAI HOSPITAL OF CARDIOVASCULAR DESEASE CHINESE ACAD OF MEDICAL SCI