Novel TALEN carrier suitable for sorangium cellulosum and construction method of novel TALEN carrier

A technology of S. cellulosus and carrier, which is applied in the fields of biochemistry and molecular biology. It can solve the problems of slow progress in the genetic engineering of S. cellulosus and achieve the effect of promoting development and broadening the scope of application.

Inactive Publication Date: 2015-06-03
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the abundance of secondary metabolites of S. cellulosus, the construction of its genetic modification system is very important for the types and yields of its metabolites. However, due to the lack of relevant vectors and the characteristics of C. Retrofit is slow

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel TALEN carrier suitable for sorangium cellulosum and construction method of novel TALEN carrier
  • Novel TALEN carrier suitable for sorangium cellulosum and construction method of novel TALEN carrier
  • Novel TALEN carrier suitable for sorangium cellulosum and construction method of novel TALEN carrier

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0014] Embodiment 1: Construction of pET22b-ADH2 recombinant plasmid:

[0015] 1. Acquisition of ADH2 gene.

[0016] 1. Design primers:

[0017] Upstream primer: GGAATTCCATATGTCTATTCCAGAAACTCAAAAAAG

[0018] Downstream primer: GCCCTCGAGTTTAGAAGAGTCAACAACGT

[0019] 2. extract the genome of Saccharomyces cerevisiae As2.4 with kit, obtain the ADH2 gene of the band restriction site of length about 1024bp by PCR amplification as above and verify by sequencing (its nucleotide sequence is as SEQ ID NO.1 and Shown in SEQ ID NO.2, the Genbank accession number of the base sequence of the ADH2 gene is NM_001182812.1),

[0020] The PCR reaction system is as follows:

[0021]

[0022] The PCR amplification procedure is as follows:

[0023]

[0024]

[0025] The recovered PCR product was treated with NdeI and XohI at 37°C for 2h. The pET22b vector was treated with NdeI and XohI at 37°C for 2 hours, and the digested product was recovered. Ligate the two digested products at ...

Embodiment 2

[0026] Embodiment 2: Construction of TALEN target vector

[0027] The 17bp sequence in the ADH2 gene obtained by sequencing was used as the knockout target, and the Ptalen L48 and Ptalen R36 (Shanghai Stance Biological Technology Co., Ltd., catalog number: 1901 / 1902 / 1903-010) vectors were used to target the upstream and downstream of the knockout target 17bp sequence (such as figure 2 Shown in A), when the repeating unit was constructed using the FastTALE TALEN kit (Shanghai Stance Biological Technology Co., Ltd., Cat. No.: 1901 / 1902 / 1903-010), it was connected to the Ptalen L48 and Ptalen R36 vectors, and double-digested And the sequencing results showed that the knockout vector was constructed successfully ( figure 2 B). Using the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4 as primers, using the pBEP43 vector as a template, amplify the P43 promoter sequence, and digest the Ptalen L48 vector with restriction endonucleases HindIII and SpeI With the P43 promo...

Embodiment 3

[0029] Co-transformation of P43LTALEN, P43RTALEN and pET22b-ADH2

[0030] Take 3 μL of each of P43LTALEN, P43RTALEN and pET22b-ADH2, adjust the concentration to 150ng / μl, and add it to the competent cell of S. cellulosus Soce M4, and add another 3 μL of 150ng / μl pET22b-ADH2 to the competent cell fiber Put the bacteria in So ce M4, put it on ice for 2 minutes, immediately add it to the ice pre-cooled electric transfer cup, 1500V, 5.0ms for electrotransformation, immediately add it to 6mLG52 liquid medium, 30°C, 150rpm to recover for 3h , the bacterial solution added with three kinds of plasmids and a single plasmid was respectively applied to the G52 plate containing 100 μg / ml Amp, 50 μg / ml Kan and the G52 plate containing only 100 μg / ml Amp, and cultivated at 37 ° C. Single clones were picked for expansion and cultured, and the bacterial solution was identified by PCR. The primers used were shown in SEQ ID NO.1 and SEQ ID NO.2. Such as Figure 4 As shown, the PCR fragment (L...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a novel TALEN carrier suitable for sorangium cellulosum and a construction method of the novel TALEN carrier. The construction method comprises the following steps: firstly, replacing a promoter suitable for eucaryon with a promoter P43 suitable for escherichia coli and bacillus subtitles; and transferring TALEN elements of a left arm and a right arm of the successfully constructed target gene and the target gen into the sorangium cellulosum, and validating whether the recombinant protein is expressed with Western blot, so as to validate that the constructed carrier can perform the function of knocking out the gene in the sorangium cellulosum. The application range of a TALEN technique is further expanded; and the development of a biotechnology is promoted.

Description

Technical field: [0001] The invention belongs to the fields of biochemistry and molecular biology, and in particular relates to a TALEN carrier suitable for S. cellulosus and a construction method thereof. Background technique: [0002] TALE is a class of highly specific DNA-binding proteins from plant pathogenic bacteria Xanthomonas genus (Sanjana NE, Cong L, Zhou Y, Cunniff MM, Feng G, Zhang F.A TAL effector toolbox for genome engineering.Nature Protocols, 2012, 7:171-192.), its specificity is determined by the repeat variable region (Repeat Variable Diresidue, RVD) in its repeat unit. TALE elements mainly include TALEN elements and TALE-TF elements. Due to the advantages of high gene knockout efficiency and almost no off-target effects, TALEN elements have been widely used in genome editing of eukaryotic cells such as mammalian cells, stem cells, and plants. However, due to the lack of corresponding vectors, the application of TALEN in prokaryotes has not been reported y...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/74C12N15/55C12N15/66
Inventor 叶伟章卫民
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap