Specific binding PRRS (Porcine Reproductive and Respiratory Syndrome) virus non-structural protein Nsp9 nanobody and application thereof

A non-structural protein and nano-antibody technology, applied in the direction of anti-viral immunoglobulin, application, antibody, etc., can solve the problems of no PRRS virus and limited protective effect, and achieve the effect of inhibiting the proliferation of PRRS virus

Active Publication Date: 2015-06-17
NORTHWEST A & F UNIV
View PDF3 Cites 21 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because PRRS virus has the characteristics of antigenic variability, macrophage, antibody-dependent enhancement (ADE) and persistent infection (Chand R J: Pathogenesis of porcine reproductive and respiratory syndrome virus.Curr Opin Virol,2012,2(3 ):256-263), the protective effect of existing vaccines on the disease is very limited, and there is no specific drug against PRRS virus at present

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific binding PRRS (Porcine Reproductive and Respiratory Syndrome) virus non-structural protein Nsp9 nanobody and application thereof
  • Specific binding PRRS (Porcine Reproductive and Respiratory Syndrome) virus non-structural protein Nsp9 nanobody and application thereof
  • Specific binding PRRS (Porcine Reproductive and Respiratory Syndrome) virus non-structural protein Nsp9 nanobody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Construction of a nanobody library directed at PRRS virus nonstructural protein Nsp9:

[0025] (1) Mix 5ml of Nsp9 recombinant protein (1mg / ml) with Freund's adjuvant in equal volume and emulsify it evenly, and immunize an Alxa Bactrian camel once every two weeks, a total of 5 times, except for the first use Freund's complete adjuvant was used, and Freund's incomplete adjuvant was used for the remaining several times. (2) After the 4 times of immunization, the camel peripheral blood lymphocytes were extracted and total RNA was extracted, and the operation was performed according to the instructions of the QIAGEN RNA extraction kit. (3) According to Invitrogen III First strand synthesis system kit instructions, reverse transcribe the extracted RNA into cDNA and use nested PCR to amplify the VHH chain, the first round of PCR:

[0026] Upstream primer: GTCCTGGCTGCTCTTCTACAAGG

[0027] Downstream primer: GGTACGTGCTGTTGAACTGTTCC

[0028] Amplify the fragment ...

Embodiment 2

[0034] Example 2: Nanobody screening process against Nsp9:

[0035] (1) Nsp9 recombinant protein (10 μg / well) dissolved in 0.01 molar pH7.4 PBS was coated on a NUNC microtiter plate, and placed overnight at 4° C., and a negative control was set up at the same time. (2) Add 200 microliters of 2.5% skimmed milk powder the next day, and block at room temperature for 2 hours. (3) After 2 hours, add 100 μl phage (1x10 11 pfu camel nanobody phage display gene library), at room temperature for 1 hour. (4) Wash 15 times with PBST (PBS containing 0.05% Tween 20) to wash away unbound phages. (5) Triethylamine (100 mM) was used to elute the phages specifically binding to Nsp9, and the phages were infected with Escherichia coli TG1 which was growing in logarithmic phase, and the phages were produced and purified for the next round of screening. After 3 rounds of screening, positive clones were enriched.

Embodiment 3

[0036] Example 3: Identification of a single positive clone by enzyme-linked immunosorbent assay (ELISA):

[0037] (1) After three rounds of screening, the TG1 cells infected with phage were spread on the LB-AMP agar plate according to a certain dilution ratio, and 96 single clones were randomly picked and inoculated in the TB-AMP medium to grow to the logarithmic phase, Add IPTG at a final concentration of 1 mM, and culture overnight at 37°C. (2) Collect the bacteria, freeze and thaw once at -20°C, and the supernatant should contain nanobody fragments. (3) Add 100 μl of supernatant to the wells of the ELISA plate coated with Nsp9, and add 100 μl of the supernatant to the wells of the control protein Nsp4-coated and uncoated ELISA plates respectively, and place at room temperature for 1 hour. (4) Wash 5 times with PBST, add Rabbit anti-E tag antibody (polyclonal antibody of rabbit origin, purchased from Nanjing GenScript Company), and let stand at room temperature for 1 hour....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a specific PRRS (Porcine Reproductive and Respiratory Syndrome) virus non-structural protein Nsp9 nanobody and discloses a VHH (Variable Domain of Heavy-chain Antibody) sequence of the nanobody and a DNA sequence encoding the nanobody at the same time. The invention further provides an expression vector which can express nanobody-eGFP fusion protein in an Marc145 cell. The Nsp9 nanobody can be specifically bound with PRRS virus non-structural protein Nsp9, and has functions of inhibiting multiplication of a classic strain and a highly pathogenic strain of a PRRS virus in the Marc-145 cell. The nanobody can be developed into a drug for treating a PRRS, and a gene corresponding to the nanobody can be used for development of a PRRS resistance transgenic pig.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a nanobody against PRRS virus non-structural protein Nsp9 and its application in anti-PRRS virus. Background technique [0002] Porcine reproductive and respiratory syndrome (PRRS), also known as blue ear disease, is an acute infectious disease of pigs caused by PRRS virus (PRRSV) infection. Because PRRS virus has the characteristics of antigenic variability, macrophage, antibody-dependent enhancement (ADE) and persistent infection (Chand R J: Pathogenesis of porcine reproductive and respiratory syndrome virus.Curr Opin Virol,2012,2(3 ):256-263), the protective effect of existing vaccines on the disease is very limited, and there is no specific drug against PRRS virus at present. [0003] PRRS virus is a single-stranded positive-strand RNA virus, and its gene replication and transcription depend on non-structural proteins encoded by the virus itself, among which the non-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K16/10C12N15/13C12N15/85A61K39/395A61P31/14A01K67/027
Inventor周恩民刘红亮
OwnerNORTHWEST A & F UNIV