A pcr kit for simultaneous detection of dog, pig and chicken feces pollution in water and its detection method
A kit and chicken feces technology, applied to PCR kits contaminated with pig and chicken feces, and simultaneously detecting dogs in water, can solve problems such as multiple pollution sources that have not been disclosed, and achieve accurate judgment, reduce misjudgment, and good specificity. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1: To dog, pig, chicken feces separate or random two kinds of combined detection
[0032] PCR method and kit for simultaneous detection of dog, pig and chicken feces pollution in water bodies, including primers, Taq enzyme, dNTP, PCR buffer, Mg 2+ solution and ddH 2 0, where primers include:
[0033] Primer 1: 5'‐CTGTGCTATGTCAGTATCTCCAG‐3'
[0034] Primer 2: 5'‐GGCTGATTAGTCATTAGTCCATCG‐3'
[0035] Primer 3: 5'‐CTACTCATACCCAGCAAGCC‐3'
[0036] Primer 4: 5'‐TAGGAATTAATAGGGCGGGTG‐3'
[0037] Primer 5: 5'‐CACATGTTATCTGCACCAGC‐3'
[0038] Primer 6: 5'‐GTTAAGGGTACGAGTTTGTCG‐3'
[0039] The above PCR primers were custom-synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.
[0040] ddH above 2 O is sterile double distilled water. The concentration of Taq enzyme is 5U / ul. Mg 2+ The concentration of the solution is 25mmol / L, which is MgCl 2 solution. The concentration of dNTPs was 2.5 mmol / L. PCR buffer is 10×PCR buffer (purchased from Takara, CodeNo.R...
Embodiment 2
[0045] Embodiment 2: Simultaneously detect dog, pig, chicken feces
[0046] Weigh 0.05 grams of dog, pig, and chicken feces, mix and extract DNA, and use the mixed DNA as a template for PCR amplification. The PCR reaction system is: 5ul of 10×PCR buffer; 5ul of dNTP; 0.25ul of Taq enzyme; 4ul of 25mmol / L Mg 2+ solution; 3ul of mixed primers 1-6, each primer at a concentration of 4ul template DNA; sterilized ddH 2 Make up to 50ul with O; the reaction conditions are 95°C, pre-denaturation for 5min; 40 cycles of 95°C for 30s, 59°C for 30s, 72°C for 45s; 72°C for 7min, and storage at 4°C.
[0047] After the PCR reaction, 5ul of the PCR products of the three fecal DNAs were respectively taken for 1% agarose gel electrophoresis. The electrophoresis conditions were voltage 80V, current 400mA, and time 25min.
[0048] After electrophoresis, observe the gel under ultraviolet light, the gel picture is as follows: figure 2 shown. ddH 2 There is no band in the negative control with ...
Embodiment 3
[0049] Example 3: Kit specificity verification
[0050] The specificity of the kit and the PCR method in the present invention is verified by using human, cattle, sheep and duck feces DNA. Collect fresh human, cow, sheep, and duck feces to extract DNA, use these four feces DNA as templates for PCR amplification, and use mixed feces DNA from dogs, pigs, and chickens as positive controls, ddH 2 0 is a negative control, the PCR reaction system and conditions are the same as in Example 2, and the gel electrophoresis conditions are the same as in Example 2, and the results are as follows image 3 shown. Negative control and people, cattle, sheep, duck feces DNA are all without any band in the PCR product of template, and the band that length is 390bp, 490bp and 783bp appeared in the positive control, illustrates the kit among the present invention and used The specificity of the PCR method is good, and there will be no false positive results.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


