Unlock instant, AI-driven research and patent intelligence for your innovation.

A pcr kit for simultaneous detection of dog, pig and chicken feces pollution in water and its detection method

A kit and chicken feces technology, applied to PCR kits contaminated with pig and chicken feces, and simultaneously detecting dogs in water, can solve problems such as multiple pollution sources that have not been disclosed, and achieve accurate judgment, reduce misjudgment, and good specificity. Effect

Active Publication Date: 2017-11-10
NANJING UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the currently commonly used fecal pollution traceability method based on PCR means can only detect the pollution source alone (Caldwell JM and Levine JF. Domestic wastewater influent profiling using mitochondrial real‐time PCR for source tracking animal contamination. Journal of microbiological methods 2009; ):17‐22. Schill WB and Mathes MV. Real‐time PCR detection and quantification of mine potential sources of fecal contamination by analysis of mitochondrial cytochrome b targets. Environmental Science & Technology 2008; 42(14):5229‐5234.)
There are currently no publicly available assays capable of differentiating between multiple sources of contamination

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A pcr kit for simultaneous detection of dog, pig and chicken feces pollution in water and its detection method
  • A pcr kit for simultaneous detection of dog, pig and chicken feces pollution in water and its detection method
  • A pcr kit for simultaneous detection of dog, pig and chicken feces pollution in water and its detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: To dog, pig, chicken feces separate or random two kinds of combined detection

[0032] PCR method and kit for simultaneous detection of dog, pig and chicken feces pollution in water bodies, including primers, Taq enzyme, dNTP, PCR buffer, Mg 2+ solution and ddH 2 0, where primers include:

[0033] Primer 1: 5'‐CTGTGCTATGTCAGTATCTCCAG‐3'

[0034] Primer 2: 5'‐GGCTGATTAGTCATTAGTCCATCG‐3'

[0035] Primer 3: 5'‐CTACTCATACCCAGCAAGCC‐3'

[0036] Primer 4: 5'‐TAGGAATTAATAGGGCGGGTG‐3'

[0037] Primer 5: 5'‐CACATGTTATCTGCACCAGC‐3'

[0038] Primer 6: 5'‐GTTAAGGGTACGAGTTTGTCG‐3'

[0039] The above PCR primers were custom-synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.

[0040] ddH above 2 O is sterile double distilled water. The concentration of Taq enzyme is 5U / ul. Mg 2+ The concentration of the solution is 25mmol / L, which is MgCl 2 solution. The concentration of dNTPs was 2.5 mmol / L. PCR buffer is 10×PCR buffer (purchased from Takara, CodeNo.R...

Embodiment 2

[0045] Embodiment 2: Simultaneously detect dog, pig, chicken feces

[0046] Weigh 0.05 grams of dog, pig, and chicken feces, mix and extract DNA, and use the mixed DNA as a template for PCR amplification. The PCR reaction system is: 5ul of 10×PCR buffer; 5ul of dNTP; 0.25ul of Taq enzyme; 4ul of 25mmol / L Mg 2+ solution; 3ul of mixed primers 1-6, each primer at a concentration of 4ul template DNA; sterilized ddH 2 Make up to 50ul with O; the reaction conditions are 95°C, pre-denaturation for 5min; 40 cycles of 95°C for 30s, 59°C for 30s, 72°C for 45s; 72°C for 7min, and storage at 4°C.

[0047] After the PCR reaction, 5ul of the PCR products of the three fecal DNAs were respectively taken for 1% agarose gel electrophoresis. The electrophoresis conditions were voltage 80V, current 400mA, and time 25min.

[0048] After electrophoresis, observe the gel under ultraviolet light, the gel picture is as follows: figure 2 shown. ddH 2 There is no band in the negative control with ...

Embodiment 3

[0049] Example 3: Kit specificity verification

[0050] The specificity of the kit and the PCR method in the present invention is verified by using human, cattle, sheep and duck feces DNA. Collect fresh human, cow, sheep, and duck feces to extract DNA, use these four feces DNA as templates for PCR amplification, and use mixed feces DNA from dogs, pigs, and chickens as positive controls, ddH 2 0 is a negative control, the PCR reaction system and conditions are the same as in Example 2, and the gel electrophoresis conditions are the same as in Example 2, and the results are as follows image 3 shown. Negative control and people, cattle, sheep, duck feces DNA are all without any band in the PCR product of template, and the band that length is 390bp, 490bp and 783bp appeared in the positive control, illustrates the kit among the present invention and used The specificity of the PCR method is good, and there will be no false positive results.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a PCR kit capable of simultaneously detecting fecal pollution of dogs, pigs and chickens in water and a detection method thereof, belonging to the field of detection of water body fecal pollution. The kit capable of simultaneously detecting fecal pollution of dogs, pigs and chickens in water comprises a primer, dNTP, PCR buffer, a Mg<2+> solution and ddH20. The method for detecting the water body fecal pollution by utilizing the kit comprises the following steps: extracting DNA of a to-be-detected water sample, taking the DNA as a template, performing PCR amplification by utilizing the primer, dNTP, PCR buffer, Taq enzymes, Mg<2+> solution and ddH20 provided in the kit, performing agarose gel electrophoresis on the PCR product, observing under an ultraviolet lamp, wherein if stripes of 390bp, 490bp and 783bp occur, fecal pollution of dogs, pigs and chickens respectively exists in the water. According to the kit, the fecal pollution of dogs, pigs and chickens, which independently exists or exists in a random combination manner in water can be accurately detected, more than three types of fecal pollution can be simultaneously detected at most, the detection time and cost can be greatly saved when a fecal pollution source is checked, and the method has good application prospects.

Description

technical field [0001] The invention relates to the field of water body pollution detection, and more specifically relates to a PCR kit and a detection method for simultaneous detection of dog, pig and chicken feces pollution in water. Background technique [0002] In recent years, with the growth of population and economy, water pollution has become increasingly serious, especially fecal pollution. Fecal pollutants will not only increase the nitrogen and phosphorus content of the water body after entering the water body, resulting in eutrophication of the water body, but also bring in the pathogenic bacteria that may exist in the feces, causing the water body transmission of diseases (Baldursson S and Karanis P. Waterborne transmission of protozoan parasites: Review of worldwide outbreaks‐An update 2004‐2010. Water Research 2011;45(20):6603‐6614.). Therefore, it is urgent to carry out the prevention and control of fecal pollution in water bodies. [0003] There are many p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6876
Inventor 张徐祥何席伟陈慧梅于红霞史薇
Owner NANJING UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com