Building method of mouse model for expressing human NTCP (Na+/taurocholate Cotransporting Polypeptide) as hepatitis b virus receptor

A construction method and mouse model technology, which can be applied in other methods of inserting foreign genetic materials, recombinant DNA technology, animal husbandry, etc., can solve the problem of lack of continuous and stable expression of human NTCP mouse model, lack of expression of human NTCP mouse model and other issues, to achieve the effect of advanced evaluation system, technology platform, and rich research methods

Inactive Publication Date: 2015-08-26
中国人民解放军第四五八医院
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The technical problem to be solved by the present invention is to overcome the lack of a mouse model expressing human NTCP in the prior art, especially the lack of a mouse model that continuously and stably expresses human NTCP, and to provide a method for expressing hepatitis B virus receptor-human NTCP. Method for constructing a mouse model of NTCP

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Building method of mouse model for expressing human NTCP (Na+/taurocholate Cotransporting Polypeptide) as hepatitis b virus receptor
  • Building method of mouse model for expressing human NTCP (Na+/taurocholate Cotransporting Polypeptide) as hepatitis b virus receptor
  • Building method of mouse model for expressing human NTCP (Na+/taurocholate Cotransporting Polypeptide) as hepatitis b virus receptor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The human NTCP gene eukaryotic expression frame was obtained from pcDNA6-hNTCP by PCR technology, and the BglII-SalI double restriction site was introduced, and then it was inserted between the attB and attP sites of the plasmid zy781, and after the action of the arabinose-induced recombinase ФC31 The minicircle DNA (pMC-CMV-hNTCP) carrying the human NTCP eukaryotic expression cassette was obtained.

[0039] S1. Obtaining the eukaryotic expression cassette of the human NTCP gene: using the pcDNA6-hNTCP plasmid (the plasmid sequence is shown in SEQ ID NO: 1) as a template, design and amplify the forward direction of the eukaryotic expression cassette of the human NTCP gene (with BglII digestion) site) and reverse primer (with SalI restriction site):

[0040] Forward primer F: 5'- GAAGATCTCCCGATCCCCTAT -3'

[0041] Reverse primer R: 5'- ACGCGTCGACCCATAGAGCCCACC -3'

[0042] The PCR reaction system and reaction procedure are as follows:

[0043]

[0044] Reaction con...

Embodiment 3

[0064] The present invention also uses conventional eukaryotic expression vectors in the field to mediate human NTCP gene preparation animal models, for example, the eukaryotic recombinant expression vector pcDNA6-hNTCP is also introduced into ICR mice by hydrodynamic transfection technology to prepare and express human NTCP genetic mouse model. However, it was found that when the conventional eukaryotic expression vector was used to mediate the human NTCP gene, the prepared mouse model could not continuously express the human NTCP gene, and could not meet the quality requirements of the animal model. And adopt the plasmid ZY781 mentioned in the present invention and engineering bacterium E. coli ZYCY10P3S2T is used to prepare the microcircle eukaryotic expression vector carrying human NTCP, optimize the induction microcircle production conditions, and finally obtain the microcircle eukaryotic expression vector carrying human NTCP in one step, reducing steps, eliminating ...

Embodiment 4

[0065] Example 4 A mouse model expressing human NTCP was prepared with the minicircle pMC-hNTCP carrying the eukaryotic expression cassette of human NTCP gene.

[0066] 1. Preparation of human NTCP gene-transfected mice by hydrodynamic transfection technology: Select 6-8 week old ICR mice with a body weight of 26-28 g. Divided into three groups: experimental group, control group, blank control group. In the experimental group, 15 μg of microcircle DNA carrying the human NTCP eukaryotic expression cassette was dissolved in 2.5 ml of normal saline, in the control group, 15 μg of pcDNA was dissolved in 2.5 ml of normal saline, and in the blank control group, 2.5 ml of normal saline was used. Inject into mice within 5-8s.

[0067] 2. PCR screening and identification of gene-transfected mice: On the 1st and 14th day, respectively, 2 mice in each group were taken to collect liver tissue, and the liver tissue DNA was extracted for PCR detection.

[0068] Forward primer F:...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a building method of a mouse model for expressing human NTCP (Na+ / taurocholate Cotransporting Polypeptide) as a hepatitis b virus receptor. A human NTCP gene carried micro ring carrier is built and introduced into a mouse body in a hydrodynamic transfection type transgenic mode so as to enable human NTCP genes to be expressed in a mouse liver. According to the building method of the mouse model for expressing the human NTCP as the hepatitis b virus receptor, the defect that the existing experimental mouse cannot be naturally infected with an HBV (Hepatitis B Virus) is overcome due to the mouse model, the mouse model comprising the HNV functional receptor is built, the HBV in-vivo infection can be supported, the normal immune function is achieved, and accordingly the clinical HBV occurrence, development and chronic process can be really and fully reflected and the ideal animal model is provided for the further research on a pathogenic mechanism of the HBV, the pathological changes of the engine body after the HBV infection and an action mechanism of an engine body immune system in the process of antiviral infection and immune pathogenesis.

Description

Technical field [0001] The present invention is a technical field of animal model preparation, which involves a method of building a mouse model that expresses hepatitis B virus receptor -human NTCP. Background technique [0002] Hepatitis B Virus (HBV) infection is a major issue that affects human health globally.Chronic hypomential inflammatory lesions caused by HBV infection often develop to liver cirrhosis, liver cancer and eventually lead to death.According to the World Health Organization, about 2 billion people around the world have infected HBV and currently about 350 million people are chronic infected by HBV. These people have progressing the risk of cirrhosis, liver failure or liver cancer.30%of the global cirrhosis and more than 50%of liver cancer are caused by HBV infections. The number of deaths caused by HBV infections is about 1 million to 2 million each year.Liver disease caused by HBV infection is still a major public health problem that needs to be solved.For a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/87A01K67/027
Inventor李秀梅刘光泽张振伟孔祥平
Owner中国人民解放军第四五八医院