Porcine alpha interferon gene and synthetic method thereof

A technology of interferon alpha and a synthetic method, applied in the field of genetic engineering, can solve the problems of complicated purification process, limited clinical and scientific application, and high cost

Inactive Publication Date: 2015-09-02
JIANGSU HFQ BIO TECH CO LTD
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The natural porcine IFN-α induced by inducers is expensive due to many reasons such as few sources, high cost, and complicated purification process, which greatly limits the clinical and scientific applications. System, so that it can be efficiently expressed, and the production of interferon with the advantages of low cost, broad-spectrum antiviral activity, non-toxicity, and no residue is undoubtedly an effective way to promote the application of interferon in veterinary clinics

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine alpha interferon gene and synthetic method thereof
  • Porcine alpha interferon gene and synthetic method thereof
  • Porcine alpha interferon gene and synthetic method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 A porcine interferon alpha gene and its synthesis method

[0020] A pig interferon alpha gene, its DNA sequence is as follows:

[0021] tgtgacctacctcaaacgcattctctagctcatacaagagcactaagactgctggcacaaatgagaagaatctcccctttctcttgtctggatcatagaagagacttcggaagtccacacgaagcttttggaggtaaccaagttcaaaaggctcaagctatggcattggtacatgaaatgctgcagcaaactttccaacttttctccaccgaaggttcagctgctgcatgggatgaatctcttttgcaccaattttgtaccggtttggatcagcagttgagagacttggaagcttgcgttatgcaggaagctggcttagaagggactccattgttagaagaggattctatattggccgttcgaaaatactttcacaggttaactttgtatcttcaggagaagagttatagtccctgcgcctgggagattgtccgtgccgaggtgatgaggtccttttcttcatcacgtaatcttcaggatcgtttacgaaagaaagagtaa。

[0022] The specific synthetic method is carried out according to the following steps:

[0023] (1) Synthesis of porcine interferon-α gene

[0024] Log in to GeneBank, search for the gene sequence (serial number: ACV42395.1) encoding porcine interferon-α mature protein, use SignalP 3.0Server software to predict that this gene may...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a porcine alpha interferon gene and a synthetic method thereof. The gene provided by the invention has the advantages that the high expression of the interferon in pichia pastoris is realized; porcine alpha interferon protein with antiviral activity is acquired; the anti-VSV activity of the porcine alpha interferon gene prepared from the synthetic method is (3.82*107) U / mg. The synthetic method designs the coding nucleotide sequence of the porcine alpha interferon on the basis that the amino acid sequence of the porcine alpha interferon is not changed; each codon in a reading frame is preferred by pichia pastoris; the coding nucleic acid is designed in the synthetic steps; a proper expression vector is inserted in the synthetic nucleic acid to build recombinant expression vector; finally the built recombinant expression vector converts proper pichia pastoris for inducible expression; the result shows the high expression of the porcine alpha interferon in the pichia pastoris, and the porcine alpha interferon protein with antiviral activity is acquired; the synthetic method is suitable for the synthesis of the porcine alpha interferon.

Description

technical field [0001] The invention belongs to the field of genetic engineering and relates to a gene and a synthesis method thereof, in particular to a porcine alpha interferon gene and a synthesis method thereof. Background technique [0002] Interferon is mainly produced by animal cells under the action of inducers such as viruses. Many animals, including humans, mammals, birds, fish, etc., can produce interferon. According to the antigenic properties and molecular structure of interferon, it is divided into different types. Interferon (IFN) is divided into type I and type II. Type I interferon gene lacks introns, including 5 types of α, β, δ, ω, and τ. Type II has only one type γ, which contains introns . They have related structures and share the same receptor (primary receptor), which is widely distributed, including monocytes / macrophages, polymorphonuclear leukocytes, B cells, T cells, platelets, epithelial cells, endothelial cells cells and tumor cells. Express...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/21C12N15/10C12N15/81C12R1/84
Inventor 符雷郗洪生田柳蒋德意
Owner JIANGSU HFQ BIO TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products