Porcine alpha interferon gene and synthetic method thereof
A technology of interferon alpha and a synthetic method, applied in the field of genetic engineering, can solve the problems of complicated purification process, limited clinical and scientific application, and high cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1 A porcine interferon alpha gene and its synthesis method
[0020] A pig interferon alpha gene, its DNA sequence is as follows:
[0021] tgtgacctacctcaaacgcattctctagctcatacaagagcactaagactgctggcacaaatgagaagaatctcccctttctcttgtctggatcatagaagagacttcggaagtccacacgaagcttttggaggtaaccaagttcaaaaggctcaagctatggcattggtacatgaaatgctgcagcaaactttccaacttttctccaccgaaggttcagctgctgcatgggatgaatctcttttgcaccaattttgtaccggtttggatcagcagttgagagacttggaagcttgcgttatgcaggaagctggcttagaagggactccattgttagaagaggattctatattggccgttcgaaaatactttcacaggttaactttgtatcttcaggagaagagttatagtccctgcgcctgggagattgtccgtgccgaggtgatgaggtccttttcttcatcacgtaatcttcaggatcgtttacgaaagaaagagtaa。
[0022] The specific synthetic method is carried out according to the following steps:
[0023] (1) Synthesis of porcine interferon-α gene
[0024] Log in to GeneBank, search for the gene sequence (serial number: ACV42395.1) encoding porcine interferon-α mature protein, use SignalP 3.0Server software to predict that this gene may...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap