Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant expression and application of reconstructed fenneropenaeus chinensiss antifungal protein gene ALFm

A technology of antibacterial protein and prawn, applied in the field of genetic engineering, can solve the problems of low yield and high cost of small peptides, and achieve far-reaching effects

Inactive Publication Date: 2016-01-20
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the cost of using chemical methods to synthesize small peptides is high and the yield is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant expression and application of reconstructed fenneropenaeus chinensiss antifungal protein gene ALFm
  • Recombinant expression and application of reconstructed fenneropenaeus chinensiss antifungal protein gene ALFm
  • Recombinant expression and application of reconstructed fenneropenaeus chinensiss antifungal protein gene ALFm

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0039] The modified antibacterial protein gene ALFm of Penaeus chinensis has the following sequence:

[0040] (1) Information of SEQIDNo.1 (see sequence listing)

[0041] (a) Sequential features

[0042] * Length: 327 bp

[0043] *Type: nucleic acid

[0044] * Chain type: double chain

[0045] *Topology: Linear

[0046] (b) Molecular type: cDNA

[0047] (c) Assumption: No

[0048] (d) Antisense: No

[0049] (e) Original source: Chinese prawn (Fenneropenaeuschinensis)

[0050] Sequence description: SEQIDNo.1

[0051] GATGATGATGATAAGTCTGGTTGGGAAGCTCTGGTTCCAGCTATTGCTGATAAGTTGACTGGTTTGTGGGAATCTGGTGAATTGGAATTGTTGGGTCATTACTGTAAGTTTAAGGTTAAGCCAAAGTTTAAGAGATGGAAGTTGAAGTTTAAGGGTAGAATGTGGTGTCCAGGTTGGACTACTATTGGTGGTCAAGCTGAAACTAGATCTAGATCTGGTGTTGTTGGTAGAACTACTCAAGATTTTGTTAGAAAGGCTTTTAGAGCTGGTTTGATTACCGAATCTGAAGCTCAAGCTTGGTTGAACAAC

[0052] CATCATCATCATCATCAT

[0053] (2) Information of SEQ ID No.2

[0054] (a) Sequential features

[0055] * Length: 109 amino acid residues

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant expression and application of a reconstructed fenneropenaeus chinensiss antifungal protein gene ALFm. Reconstruction is carried out with a fenneropenaeus chinensiss anti-lipopolysaccharide factor FcALF2 as an archetype, reconstructed antifungal protein is named ALFm, and has a base sequence shown in SEQ ID No.1 and an amino acid sequence shown by SEQ ID No.2. An expression vector pPIC9K and expression strain pichia pastoris GS115 are utilized for carrying out eukaryon recombinant expressions on ALFm, and recombinant protein with biological activity is obtained. The biological function of ALFm is verified in vitro, and it is proved that the recombinant protein can have effective inhibiting effects on various bacteria and WSSV.

Description

technical field [0001] The invention relates to genetic engineering, in particular to the recombinant expression and application of a modified Chinese prawn antibacterial protein gene ALFm. Background technique [0002] Shrimp farming is one of the pillar industries of mariculture. With the increasing market demand for high-quality aquatic products, shrimp farming occupies an increasingly important position in aquaculture. However, the explosive prevalence of shrimp diseases has caused huge losses to shrimp farming, and the frequent occurrence of shrimp diseases caused by various bacterial viruses has plagued the development of shrimp farming. At present, antibiotics, hormones and other drugs in aquaculture, although they play a certain role in disease control, they also destroy the micro-ecological balance of the water environment and animals, causing aquatic animals to lose their normal flora barrier and biological antagonism. At the same time, the abuse of antibiotics wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/435C12N15/81A61K38/17A61P31/04A61P31/20
Inventor 李富花杨辉李诗豪相建海
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com