Recombinant expression and application of reconstructed fenneropenaeus chinensiss antifungal protein gene ALFm
A technology of antibacterial protein and prawn, applied in the field of genetic engineering, can solve the problems of low yield and high cost of small peptides, and achieve far-reaching effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0039] The modified antibacterial protein gene ALFm of Penaeus chinensis has the following sequence:
[0040] (1) Information of SEQIDNo.1 (see sequence listing)
[0041] (a) Sequential features
[0042] * Length: 327 bp
[0043] *Type: nucleic acid
[0044] * Chain type: double chain
[0045] *Topology: Linear
[0046] (b) Molecular type: cDNA
[0047] (c) Assumption: No
[0048] (d) Antisense: No
[0049] (e) Original source: Chinese prawn (Fenneropenaeuschinensis)
[0050] Sequence description: SEQIDNo.1
[0051] GATGATGATGATAAGTCTGGTTGGGAAGCTCTGGTTCCAGCTATTGCTGATAAGTTGACTGGTTTGTGGGAATCTGGTGAATTGGAATTGTTGGGTCATTACTGTAAGTTTAAGGTTAAGCCAAAGTTTAAGAGATGGAAGTTGAAGTTTAAGGGTAGAATGTGGTGTCCAGGTTGGACTACTATTGGTGGTCAAGCTGAAACTAGATCTAGATCTGGTGTTGTTGGTAGAACTACTCAAGATTTTGTTAGAAAGGCTTTTAGAGCTGGTTTGATTACCGAATCTGAAGCTCAAGCTTGGTTGAACAAC
[0052] CATCATCATCATCATCAT
[0053] (2) Information of SEQ ID No.2
[0054] (a) Sequential features
[0055] * Length: 109 amino acid residues
[0...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
