Pig samhd1 gene, protein, monoclonal antibody and application thereof

A technology of monoclonal antibody and gene, applied in application, genetic engineering, plant gene improvement, etc., can solve the problems of poor protein reactivity, no reactivity, no accurate complete gene sequence of porcine SAMHD1, etc.

Active Publication Date: 2018-05-18
SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the full gene sequence of SAMHD1 has been obtained from humans, monkeys, and horses, but there is no accurate full gene sequence of pig SAMHD1, and the monoclonal antibody or polyclonal antibody prepared from human SAMHD1 has poor reactivity with pig SAMHD1 protein, almost no reactivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pig samhd1 gene, protein, monoclonal antibody and application thereof
  • Pig samhd1 gene, protein, monoclonal antibody and application thereof
  • Pig samhd1 gene, protein, monoclonal antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Using the RACE method to amplify and obtain the whole gene sequence of porcine SAMHD1

[0032] By comparing the predicted sequence of porcine SAMHD1 submitted in GenBank (Genbank ID: XM_003483952, XM_003361435, AK236802), a pair of primers were designed to amplify the partial nucleic acid sequence of SAMHD1. The sequence of the pair of primers was s880-forward: 5'-TCAAAGCAGACCCTTACAT-3'( SEQ ID NO. 3), S880-reverse: 5'-TTGCCTAATTCCTGTTTCT-3' (SEQ ID NO. 4). As a result, a partial gene sequence of pig SAMHD1 with a length of about 880bp was amplified (see figure 1A). After the sequence was sequenced and compared correctly, a pair of SAMHD1 gene-specific primers were designed according to the amplified 880bp sequence, GSP1-forward: 5'-AGATGCCTTCCTCAAAGCAGACCCT-3' (SEQ ID NO.5), GSP1-reverse: 5'-TATGCCCTAAATTGATTGGGGGGGC -3'(SEQ ID NO.6), and a pair of inner nested primers about 220bp in length are designed inside it, S220-forward: 5'-GCTGAACTGAAGGCTGAA GAT-3'(...

Embodiment 2

[0033] Example 2 Recombinant expression of porcine SAMHD1 protein

[0034] According to the pig SAMHD1 complete gene sequence amplified in Example 1, specific primers are designed to amplify the SAMHD1 coding sequence, and the specific primers for amplifying the coding gene are as follows, pcold-pig SAMHD1 (pcold-pig SAMHD1-forward: 5'- CC AAGCTT ATGCAGAGTGCCGACTCC-3' (SEQ ID NO.9), pcold-pig SAMHD1-reverse: 5'-CG GGATCC TCACACCGAGTCCTTTGCA-3'(SEQ ID NO.10)), wherein the upstream and downstream primers contain Hind III and Bam HI restriction endonuclease sites respectively, and the SAMHD1 coding sequence amplified by pcold-pig SAMHD1 primers is used to insert pcold TF DNA prokaryotic expression vector; pFLAG-pig SAMHD1 (pFLAG-pig SAMHD1 forward: C AAGCTT ATGCAGAGTGCCGACTCCCAGCAG (SEQ ID NO. 11); pFLAG-pig SAMHD1 reverse: GC TCTAGA TCACACCGAGTCCTTTGCAAA (SEQ ID NO.12)), the SAMHD1 coding sequence amplified by the pFLAG-pig SAMHD1 primer, used to insert into the p3×FLAG C...

Embodiment 3

[0037] Example 3 Preparation of porcine SAMHD1 mouse monoclonal antibody

[0038] The prokaryotically expressed and purified SAMHD1 protein in Example 2 was used as an immunogen to immunize mice for the preparation of monoclonal antibodies. Eight-week-old BABL / c female mice were selected, and the purified porcine SAMHD1 protein was immunized with prokaryotic expression. The dose of immunization is 100 micrograms of protein for the first time, and 50 micrograms for the second to fourth times, respectively, with a total volume of 100 ul, injected subcutaneously at multiple points, with an interval of two weeks. The first immunization was emulsified with Freund's complete adjuvant, SAMHD1 protein was mixed with Freund's complete adjuvant at a ratio of 1:1, and the second immunization was emulsified with Freund's incomplete adjuvant, SAMHD1 protein was mixed with Freund's incomplete adjuvant 1: Mixed at a ratio of 1, without adding adjuvant for the third and fourth immunizations,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a porcine SAMHD1 gene, which comprises a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.1. The invention also discloses the porcine SAMHD1 protein, which has the amino acid sequence shown in SEQ ID NO.1. The invention also discloses a monoclonal antibody against porcine SAMHD1 protein. The porcine SAMHD1 gene and protein of the invention have antiviral activity, are suitable for developing antiviral drugs, and have broad application prospects. The monoclonal antibody of the invention has good specific reaction with porcine SAMHD1 protein, and lays an important foundation for further research on the biological function of porcine SAMHD1 protein.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to a porcine SAMHD1 gene, protein, monoclonal antibody and application thereof. Background technique [0002] Innate immunity plays an important role in the body's resistance to pathogenic infection. It can respond quickly after pathogens invade the body, control the spread of pathogens, and then induce specific immune responses to eliminate pathogens. In the process of long-term evolution, the body has formed natural limiting factors to resist pathogenic invasion. Four natural restriction factors have been discovered so far, TRIM5α, Tetherin, APOBEC3G and SAMHD1 (Neil et al., 2008; Sheehy et al., 2002; Stremlau et al., 2004). Recent studies have confirmed that SAMHD1, as a natural restriction factor, is highly expressed in myeloid-derived cells and can prevent the replication of HIV-1 virus in myeloid-derived cells (Chen et al., 2012; Goldstone et al., 2011 ; Laguette et a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/55C12N9/14C12N15/70C12N15/85C12N1/21C12N5/10C07K16/40G01N33/577G01N33/573A61K38/46A61P31/14A61P31/18
Inventor童光志杨莘周艳君姜一峰单同领童武郑浩
OwnerSHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI