A kind of lipid compound siRNA transfection reagent
A technology for transfection reagents and compounds, which can be used in recombinant DNA technology, other methods of inserting foreign genetic materials, etc., and can solve the problems of high toxicity and low transfection efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0078] Embodiment one: the synthesis of polyamine ester compound
[0079] Polyester compounds are obtained by reacting polyamine compounds and epoxy compounds in a glass bottle equipped with a stirring bar at 90°C without solvent. The polyamine compound is selected from compounds with 4 to 10 amino functional groups, and the epoxy compound includes aliphatic compounds with different chain lengths, different characteristic functional groups and different degrees of saturation. The reaction time is 24-72 hours at 90°C. The extent of the reaction can be controlled by the amount of polyamine compound added to the reaction mixture. For example, if the polyamine compound contains 4 amino groups, adding 4 times the equivalent of epoxy compound can obtain a compound with 4 alkyl chains. This result has been confirmed by thin layer chromatography (TLC). Only one fully substituted product was present in the reaction mixture of the inventive examples.
Embodiment 2
[0080] Example 2: Preparation of transfection reagent
[0081] Preparation of transfection reagent: weigh 100mg S1C2, 100mg cationic lipid DOTAP, 100mg phospholipid DOPE, mix and dissolve in chloroform in a glass container, remove chloroform under vacuum. Then add 300ml of water, vortex and oscillate to dissolve in water, and undergo high-pressure homogenization treatment. The homogenization condition is that the pressure is 1000 Pa, and there are two cycles (ATS homogenizer).
[0082] According to the same method, when selecting corresponding amino compounds and epoxy compounds, other lipopolyamine compounds can also be prepared. In the following examples, m in the C1 compound is 12, and p in the C2 compound is 8.
Embodiment 3
[0083] Example Three: Cell Transfection
[0084] Lamin A / C siRNA:
[0085] Justice Chain: GGUGGUGACGAUCUGGGCUUU
[0086] Antisense strand: AGCCCAGAUCGUCACCACCUU
[0087] A. Cell Seeding
[0088] The day before transfection, HeLa cells in the logarithmic growth phase were seeded in a 96-well plate, and 200 μl of DMEM medium (Life Technologies) was added to each well without antibodies. Adjust the cell seeding density so that the cell density at the time of transfection was 30-50% .
[0089] B. siRNA-transfection reagent mixture preparation
[0090] 1. Dilute 6pmol siRNA with 50μl serum-free medium;
[0091] 2. 2 μl of transfection reagent (prepared in Example 1) was diluted with serum-free medium to a total volume of 50 μl. After vortexing for 10 seconds, incubate at room temperature for 5 minutes;
[0092] 3. Mix the siRNA dilution with the transfection reagent dilution (total volume 100 μl). After vortexing for 10 seconds, incubate at room temperature for 20 minutes. ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com