Unlock instant, AI-driven research and patent intelligence for your innovation.

A molecular marker, detection method and application of nr5a2 gene promoter region affecting reproductive traits in sheep

A gene promoter region and molecular marker technology, applied in the field of molecular biology, can solve the problems of inability to carry out ultra-early selection, low accuracy of phenotypic selection, and slow genetic progress, so as to improve the fecundity of Hu sheep and reduce breeding costs , The effect of speeding up the breeding process

Active Publication Date: 2017-08-25
JIANGSU ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The fecundity trait of sheep is an important economic trait, which belongs to the quantitative trait. The accuracy of traditional phenotypic selection is low, and the phenotypic value can only be gradually expressed after the ewe matures and lambs. The cycle is very long, and ultra-early selection cannot be carried out. , slow genetic progression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular marker, detection method and application of nr5a2 gene promoter region affecting reproductive traits in sheep
  • A molecular marker, detection method and application of nr5a2 gene promoter region affecting reproductive traits in sheep
  • A molecular marker, detection method and application of nr5a2 gene promoter region affecting reproductive traits in sheep

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1. The NR5A2 gene promoter region-700T / G SNPs molecular marker selection method of Hu sheep reproductive traits

[0028] Materials and Methods:

[0029] (1) Samples and reproductive traits data

[0030] The data of 192 Hu sheep and their reproductive traits were provided by Jiangsu Hailun Sheep Industry Co., Ltd. The reproductive data included the number of lambs born in the first child, the number of lambs born in the second child and the number of lamb born in the third child. Approximately 0.5g of each individual ear-picking tissue block is put into a 1.5ml Eppendoff tube, placed in an ice box, and frozen at -20°C after being brought back to the laboratory.

[0031] (2) Method

[0032] 1) Use conventional phenol and chloroform methods to extract DNA, electrophoresis and determine OD260 / 280 to detect DNA quality.

[0033] 2) According to the genebank sequence NC_019469.1, use Primer Primer 5 to design a pair of specific primers (sequence P1: AGAGCCTAAAACTAACCTTGGTC (SEQ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker, a detection method and an application of the NR5A2 gene promoter region which affects the reproductive traits of sheep. The molecular marker contains the ‑700 site in the promoter region of the NR5A2 gene, which has a T / G polymorphism; the litter size of GG and TG sheep is significantly larger than that of TT. The application of the molecular markers in screening Hu sheep strains with good reproductive traits. NR5A2 gene promoter region ‑700 site GG and TG individuals are higher than TT individuals in terms of first litter size, second litter size, third litter size and average litter size, so GG type is selected And TG-type individuals to keep species. The invention can improve the accuracy of the selection of Hu sheep's reproductive traits, and is used for super early seed selection, so as to speed up the process of cultivating new sheep varieties using Hu sheep as breeding materials.

Description

Technical field [0001] The invention belongs to the field of molecular biology, and relates to a molecular marker, detection method and application of the NR5A2 gene promoter region that affects sheep reproductive traits. Background technique [0002] The NR5A gene family consists of two members, NR5A1 and NR5A2, and plays a key role in pluripotency, glycolipid homeostasis, and steroid production. Studies have found that the NR5A family gene knockout mice have disordered steroid production and significantly decreased fertility. It can be seen that the NR5A family is a key regulator of animal fertility. NR5A2 is the second member found in the NR5A family. It plays a wide-ranging regulatory role in various mammalian life processes and even disease occurrence, especially closely related to mammalian female reproduction, follicular development, and steroid production. NR5A2 was first discovered in humans in 1993. It is expressed in various tissues of adult mammals, mainly in liver, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 李隐侠张俊曹少先钱勇孟春花钟声王慧利邢光东
Owner JIANGSU ACAD OF AGRI SCI