A molecular marker, detection method and application of nr5a2 gene promoter region affecting reproductive traits in sheep
A gene promoter region and molecular marker technology, applied in the field of molecular biology, can solve the problems of inability to carry out ultra-early selection, low accuracy of phenotypic selection, and slow genetic progress, so as to improve the fecundity of Hu sheep and reduce breeding costs , The effect of speeding up the breeding process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1. The NR5A2 gene promoter region-700T / G SNPs molecular marker selection method of Hu sheep reproductive traits
[0028] Materials and Methods:
[0029] (1) Samples and reproductive traits data
[0030] The data of 192 Hu sheep and their reproductive traits were provided by Jiangsu Hailun Sheep Industry Co., Ltd. The reproductive data included the number of lambs born in the first child, the number of lambs born in the second child and the number of lamb born in the third child. Approximately 0.5g of each individual ear-picking tissue block is put into a 1.5ml Eppendoff tube, placed in an ice box, and frozen at -20°C after being brought back to the laboratory.
[0031] (2) Method
[0032] 1) Use conventional phenol and chloroform methods to extract DNA, electrophoresis and determine OD260 / 280 to detect DNA quality.
[0033] 2) According to the genebank sequence NC_019469.1, use Primer Primer 5 to design a pair of specific primers (sequence P1: AGAGCCTAAAACTAACCTTGGTC (SEQ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


