A method for constructing a pyrosequencing library

A technology of pyrosequencing and method construction, which is applied in the fields of chemical library, biochemical equipment and method, and microbial measurement/inspection. It can solve the problems of incomplete information, large loss of reagents and samples, and low efficiency of library construction. Complete information, improve the success rate, and improve the efficiency of database construction

Inactive Publication Date: 2016-08-24
BEIJING ZHONGKEZIXIN TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The existing technology still has the problems of low library construction efficiency, large loss of reagents and samples, and incomplete information. New methods need to be constructed to solve the problems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] (1) Sample DNA extraction and quantification using Qubit Fluorometer, the concentration is 81μg / μl;

[0034] (2) DNA fragmentation, purification and fragment selection: use Covaris ultrasonic interrupter to fragment DNA, purify and recover the target fragment, quantify and select the fragment, and use Qiagen PCR purification kit for purification and use Qubit fluorometer to quantify , The concentration is 64μg / μl;

[0035] (3) Fill in the end and add an A tail: Fill in the DNA end and add an A tail at the 3'end;

[0036] (4) Y joint connection, joint is joint b:

[0037] Forward connector: 5'GTCGTACAGCTAGTCCTGAGGATGCAGTTCACTAGT3',

[0038] Reverse connector: 3'CCTAGCTGCATACGTCACACGAGTCAGTGATCTp 5'.

[0039] The labels are TCACTAGT and AGTGATCT, and the forward and reverse joints are annealed to form a partially complementary pair of Y-joints;

[0040] (5) 96 labels are designed on the joint, which can process 96 samples at a time;

[0041] (6) Use the AMPure magnetic bead purificat...

Embodiment 2

[0045] (1) Sample DNA extraction and quantification using Qubit Fluorometer, the concentration is 96μg / μl;

[0046] (2) DNA fragmentation, purification and fragment selection: use Covaris ultrasonic interrupter to fragment DNA, purify and recover the target fragment, quantify and select the fragment, and use Qiagen PCR purification kit for purification and use Qubit Fluorometer for quantification , The concentration is 71μg / μl;

[0047] (3) Fill in the end and add an A tail: Fill in the DNA end and add an A tail at the 3'end;

[0048] (4) Y connector connection, the connector is connector a:

[0049] Forward connector: 5'GCAAGTCTCGATTGGAGCTCTGCTCCAGTGCATCACT 3',

[0050] Reverse connector: 3'GTACATGCACGACTCAGTCCTGATCCGTAGTGAp 5',

[0051] The tags are GCATCACT and CGTAGTGA, and the forward and reverse connectors are annealed to form a partially complementary pair of Y-shaped connectors;

[0052] (5) 96 labels are designed on the joint, which can process 96 samples at a time;

[0053] (6) ...

Embodiment 3

[0057] (1) Sample DNA extraction and quantification using Qubit Fluorometer, the concentration is 51μg / μl;

[0058] (2) DNA fragmentation, purification and fragment selection: use Covaris ultrasonic interrupter to fragment DNA, purify and recover the target fragment, quantify and select the fragment, and use Qiagen PCR purification kit for purification and use Qubit fluorometer to quantify , The concentration is 50μg / μl;

[0059] (3) Fill in the end and add an A tail: Fill in the DNA end and add an A tail to the 3'end;

[0060] (4) Y joint connection, joint is joint b:

[0061] Forward connector: 5'GTCGTACAGCTAGTCCTGAGGATGCAGTTCACTAGT3',

[0062] Reverse connector: 3'CCTAGCTGCATACGTCACACGAGTCAGTGATCTp 5'.

[0063] The labels are TCACTAGT and AGTGATCT, and the forward and reverse joints are annealed to form a partially complementary pair of Y-joints;

[0064] (5) 96 labels are designed on the joint, which can process 96 samples at a time;

[0065] (6) Use the AMPure magnetic bead purificat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of genetic engineering and molecular biology and specifically relates to a construction method of a pyrophosphoric acid sequencing library. The construction method comprises the following steps: sample DNA extraction and quantification, DNA fragmentation, purification and fragment selection, end-filling, tail A addition, Y joint connection, design of a plurality of tabs on the joint, small fragment removal, PCR amplification to obtain an amplification product, namely a DNA library, and transformation into a single chain. The library obtained by use of the method is high in purity and high in sequencing result accuracy.

Description

Technical field [0001] The invention belongs to the fields of genetic engineering and molecular biology, and specifically relates to a method for constructing a pyrosequencing library. Background technique [0002] Pyrosequencing technology (pyrosequencing) is a new type of enzyme-linked cascade sequencing technology. Pyrosequencing is suitable for sequencing and analysis of known short sequences. Its repeatability and accuracy are comparable to Sanger DNA sequencing, and its speed But greatly improved. Pyrosequencing technology products have the ability to sequence and analyze a large number of samples at the same time, providing an ideal technical operation platform for large-throughput, low-cost, timely, fast and intuitive SNP research and clinical testing. . [0003] The improved technology can meet the sequencing work of hundreds of nucleotide sequences, so that the technology can meet the application of identification and typing of important microorganisms, mutation detecti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/10C12Q1/68C40B50/06
Inventor高静蔡亦梅徐潇吴超张睿王者馥王绪敏殷金龙任鲁风
OwnerBEIJING ZHONGKEZIXIN TECH