Method for simulation of DNA nano origami structure as drug carrier by DAPI embedding and release
A kind of origami structure and nanotechnology, which is applied in the direction of pharmaceutical formula, medical preparations of non-active ingredients, fluorescence/phosphorescence, etc., can solve the problems of expensive reagent ordering, complicated experimental design and operation, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0015] 16 12 μL of circular DNA (2 μM, sequence: 5'TATGCCCAGCCCTGTAAGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTATTCTCAACTCGTCTCTGCCCTGACTTC3'), dNTPs (4 μL, 10 mM phi2, RCA buffer (4 μL, 10 mM phi2) were added to μL primer DNA (1 μM, sequence: 5'CCAGCCTAAGAGTTGAGCA3') successively. polymerase 4μL, 10 U / μL), the final volume of the mixed solution was 40μL. Then amplified in a 30°C water bath for 30 min. 40 μL of the obtained product was subjected to 10% PAGE electrophoresis, and then recovered by slicing gel to remove small fragments of DNA, redundant circular DNA and primer DNA. Take 3 μL of the recovered product, add 12 μL of milliQ water, and add stapled strands 1-3 (100 μM, the sequence is as follows:
[0016] 5'-CAGCCCTGTAAGATGAAGATAGCGTCTATGCC-3'
[0017] 5'-CCCTGACTCACAATGGTCGGATTCCGTCTCTG-3'
[0018] 5’-TCTCAACTTCAACTCGTATTCTCAACTCGTAT-3’) 1 μL each, 2 μL TAE buffer (10×, 125 mM Mg 2+ ), the total volume is 20 μL, the solution is mixed well, placed in a hig...
Embodiment 2
[0020] 16 12 μL of circular DNA (2 μM, sequence: 5'TATGCCCAGCCCTGTAAGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTATTCTCAACTCGTCTCTGCCCTGACTTC3'), dNTPs (4 μL, 10 mM phi2, RCA buffer (4 μL, 10 mM phi2) were added to μL primer DNA (1 μM, sequence: 5'CCAGCCTAAGAGTTGAGCA3') successively. polymerase 4μL, 10 U / μL), the final volume of the mixed solution was 40μL. Then amplified in a 30°C water bath for 30 min. 40 μL of the obtained product was subjected to 10% PAGE electrophoresis, and then recovered by slicing gel to remove small fragments of DNA, redundant circular DNA and primer DNA. Take 3 μL of the recovered product, add 12 μL of milliQ water, and add stapled strands 1-3 (1 μM, the sequence is as follows:
[0021] 5'CAGCCCTGTAAGATGAAGATAGCGTCTATGCC3'
[0022] 5'CCCTGACTCACAATGGTCGGATTCCGTCTCTG3'
[0023] 5’TCTCAACTTCAACTCGTATTCTCAACTCGTAT3’, 1 μL each, 2 μL TAE buffer (10×, 125 mM Mg 2+ ), the total volume is 20 μL, the solution is mixed well, placed in a high temper...
Embodiment 3
[0025] 1612 μL of circular DNA (2 μM, sequence: 5'TATGCCCAGCCCTGTAAGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTATTCTCAACTCGTCTCTGCCCTGACTTC3'), dNTPs (4 μL, 10 mM phi2, RCA buffer (4 μL, 10 mM phi2) were added to μL primer DNA (1 μM, sequence: 5'CCAGCCTAAGAGTTGAGCA3') successively. polymerase 4μL, 10 U / μL), the final volume of the mixed solution was 40μL. Then amplified in a 30°C water bath for 30 min. 40 μL of the obtained product was subjected to 10% PAGE electrophoresis, and then recovered by slicing gel to remove small fragments of DNA, redundant circular DNA and primer DNA. Take 3 μL of the recovered product, add 12 μL of milliQ water, and add stapled strands 1-3 (1 μM, the sequence is as follows:
[0026] 5'CAGCCCTGTAAGATGAAGATAGCGTCTATGCC3'
[0027] 5'CCCTGACTCACAATGGTCGGATTCCGTCTCTG3'
[0028] 5’TCTCAACTTCAACTCGTATTCTCAACTCGTAT3’, 1 μL each, 2 μL TAE buffer (10×, 125 mM Mg 2+ ), the total volume is 20 μL, the solution is mixed well, placed in a high tempera...
PUM
| Property | Measurement | Unit |
|---|---|---|
| width | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
