Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A cotton ion channel protein and its coding gene and application

An ion channel and coding gene technology, applied to a cotton ion channel protein and its coding gene and application field, can solve the important problems of plant salt resistance that need to be explored and the mechanism is complicated

Active Publication Date: 2017-12-12
BIOCENTURY TRANSGENE CHINA
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although researchers have carried out a lot of research from different aspects, many important issues in plant salt resistance remain to be explored due to the complexity of its mechanism

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A cotton ion channel protein and its coding gene and application
  • A cotton ion channel protein and its coding gene and application
  • A cotton ion channel protein and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1 Cotton SSH library construction under salt stress:

[0018] The specific method is:

[0019] Using PCR-select from Clontech TM The method shown in the cDNA Subtraction Kit was used to construct a subtractive library by suppression subtractive hybridization. During the experiment, the mRNA of the roots of cotton seedlings treated with NaCl for 6 hours was used as the sample (tester), and the mRNA of the roots of untreated cotton seedlings was used as the control (driver).

[0020] (1) Test materials:

[0021] African cotton (National Cotton Medium-Term Bank, acquired by China Cotton Research Institute, unified number: ZM-06838) was sown on sterilized vermiculite, cultivated at 25°C, with a light-dark cycle of 16h / 8h, and watered 1 / 2 2MS medium (9.39mM KNO 3 , 0.625mM KH2PO 4 , 10.3mM NH 4 NO 3 , 0.75mM MgSO 4 , 1.5mM CaCl 2 , 50 μM KI, 100 μM H 3 BO 3 , 100 μM nSO 4 , 30 μM ZnSO 4 , 1 μM Na 2 MoO 4 , 0.1 μM CoCl 2 , 100 μM Na 2 EDTA, 100 μM Fe...

Embodiment 2

[0032] Example 2 Cloning of Cotton Ion Channel Encoding Gene GhSOS1

[0033] After the redundant DNA was removed from the clone Gh-S2-073, the sequence was SEQ ID No: 3. Sequence analysis showed that the encoded amino acid sequence of this sequence belonged to the ion channel protein SOS1. In this paper, the clone Gh-S2-073 encoded the whole The long gene is named GhSOS1, and the protein corresponding to this gene is named SOS1.

[0034] SEQ ID No: 3

[0035]

[0036] Cloning of GhSOS1 full-length gene

[0037] According to the obtained sequence of SEQ ID No: 3, two specific primers were designed as the 5' end-specific primers of 3' RACE.

[0038] GhSOS1 GSP1: SEQ ID NO: 4:

[0039] TCAGCTCTGAAACTGGAAGCCG

[0040] GhSOS1 GSP2: SEQ ID NO: 5:

[0041] CAGCAGCCAAAGCAGCGTATACT

[0042] The experimental steps were operated according to the instructions of the kit (the 3'RACE System for Rapid Amplification of cDNA Ends kit was purchased from Invitrogen).

[0043] Using S...

Embodiment 3

[0074] Example 3 GhSOS1 Gene Plant Expression Vector Construction

[0075] The plant binary expression vector pCAMBIA2300 (purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd.) was selected as the plant expression vector, and the 35S promoter of the NPTII gene containing double enhancers was replaced with the Pnos promoter to reduce the expression of NPTII protein in plants . 35S and Tnos were selected as the promoter and terminator of GhSOS1 gene.

[0076] Primers SEQ ID NO: 12 and SEQ ID NO: 13 were used to amplify Pnos using the plant expression vector PBI121 (purchased from Beijing Huaxia Ocean Technology Co., Ltd.) as a template, and TaKaRa's PrimeSTAR HS DNA polymerase was used. 50 μl PCR reaction system: 10 μl 5×PS Buffer, 3 μl 2.5 mM dNTP, 1.0 μl PBI121, 1.0 μl PrimeSTAR, 10 μM primers SEQ ID NO: 12 and 2.0 μl each of SEQ ID NO: 13, and 31 μl double distilled water. PCR reaction conditions: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided are an ion channel protein SOS1 derived from cotton, its coding gene, and its application in breeding transgenic plants with improved salt tolerance.

Description

technical field [0001] The present invention relates to an ion channel protein and its encoding gene and application, in particular to an ion channel protein SOS1 derived from cotton and its encoding gene, and its application in cultivating transgenic plants with improved salt tolerance. Background technique [0002] Salt stress is one of the most important abiotic stress hazards to agricultural production in the world. Saline soils are usually dominated by sodium, calcium or magnesium salts, which have become the main factors that affect plant growth and lead to reduced yields of food and economic crops. The area of ​​saline-alkali soil in the world is about 400 million hectares, accounting for 1 / 3 of irrigated farmland. Saline-alkali land is widely distributed in China, and the existing saline-alkali land area is about 40 million hectares. With the increase of population and the reduction of cultivated land in our country, the development and utilization of saline-alkali ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/63C12N1/21C07K14/415
CPCC07K14/415C12N15/8273
Inventor 何云蔚王建胜王君丹梁远金梁丽
Owner BIOCENTURY TRANSGENE CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com