Human protein LT-alpha interacting with hepatitis g virus E2 protein

A technology of protein interaction and human protein, applied in the field of human protein LT-α that interacts with hepatitis G virus E2 protein, can solve the problems of changing T cell activity, ambiguity, and reducing T cell activity, and achieve omics The effect of mature technology and the simplicity and wide applicability of omics technology

Active Publication Date: 2015-11-25
KUNMING UNIV OF SCI & TECH
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

(2) Short peptides in the GBV-CNS5A region may prevent HIV-1 from entering cells by inhibiting the expression of HIV-1 co-receptors CCR5 and CXCR4 in T cells
(5) GBV-C reduces the activity of T cells by reducing the expression of LCK protein in the T cell signaling pathway, resulting in a significant decrease in the expression of CD38, CD69, CD25 and CCR5 molecules, affecting the replication of HIV-1
At present, the research on the mechanism of GBV-C inhibiting the proliferation of HIV-1 mainly focuses on the two aspects of GBV-C hindering the process of HIV-1 cell entry and changing the activity of T cells. E2 and NS5A short peptides can inhibit HIV-1 replication, but which target proteins on the GBV-CE2 protein and its shared host directly interact, thereby preventing HIV-1 from entering cells and affecting T cell activity and other effects. The function of the target protein is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human protein LT-alpha interacting with hepatitis g virus E2 protein
  • Human protein LT-alpha interacting with hepatitis g virus E2 protein
  • Human protein LT-alpha interacting with hepatitis g virus E2 protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1: Screening for Human Proteins Interacting with Hepatitis G Virus E2 Protein

[0056] 1. Cloning and identification of hepatitis G virus E2 gene

[0057] Analyze the target gene fragment sequence and the multiple cloning site information of the connected vector, and design primers: 5' end primer pGBKT7-E25'-CCG GAATTC GGCGCCCCGGCCTCGGTGCTAG, the underlined part is the EcoRI restriction site;

[0058] 3' end primer pGBKT7-E2 3'-ACG CGTCGA CCCTGCCCGAGGAGAGCCATGCGAAC, the underlined part is the SalⅠ restriction site;

[0059] PCR amplification of cDNA of hepatitis G virus type 7 to obtain gene fragments, 50 μl PCR system: 1 μl upstream primer, 1 μl downstream primer, 25 μl rTaq mixture, ddH 2 O2 1μl, template 2μl; PCR conditions: 94°C pre-denaturation for 5min, 35 cycles; 94°C for 30s, 50°C for 30s, 72°C for 2min, and final extension at 72°C for 7min; PCR products were identified by 1% agarose gel electrophoresis for fragment size .

[0060] 2. Construction...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses human protein LT-alpha interacting with hepatitis g virus E2 protein. An amino acid sequence of the human protein LT-alpha is shown as SEQ ID NO.1, and a nucleotide sequence for coding genes of the human protein LT-alpha is shown as SEQ ID NO.2. The human protein LT-alpha capable of achieving interaction with the hepatitis g virus E2 protein is obtained by screening a human T lymphocyte cDNA gene bank through a hepatitis g virus by utilizing a fourth-generation yeast two-hybrid method, and positive verification is performed on the interacting protein through a co-immunoprecipitation method. According to the human protein LT-alpha, a certain theoretical basis is provided for studying the action mechanism between the hepatitis g virus and an HIV-1 virus.

Description

technical field [0001] The invention relates to the research method and genetic engineering field of interacting proteins in the inhibitory effect of hepatitis G virus on HIV-1, in particular to a human protein LT-α interacting with hepatitis G virus E2 protein. Background technique [0002] Given that hepatitis G virus (GBVirusC, GBV-C) itself is not pathogenic, but co-infection with HIV-1 is beneficial to delay the course of HIV-1 patients, elucidating the mechanism of GBV-C's inhibition of HIV-1 will be GBV -C is applied to the key scientific issues to be solved in the treatment of HIV-1 disease. Based on the research progress at home and abroad, the inhibitory effect of GBV-C on HIV-1 mainly includes the following aspects: (1) The envelope glycoprotein E2 of GBV-C hinders the entry of HIV through the combination with HIV-1 Gp41. (2) Short peptides in the GBV-CNS5A region may prevent HIV-1 from entering cells by inhibiting the expression of HIV-1 co-receptors CCR5 and CX...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/525C12N15/28
CPCC07K14/5255
Inventor冯悦杨晓钰夏雪山刘晓佳赵跃
OwnerKUNMING UNIV OF SCI & TECH