A kind of olive betaine dehydrogenase badh and its coding gene and application
A betaine dehydrogenase, gene technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problem of not reaching the standard of industrialization and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1. Construction of the SSH library of Larvae under salt stress:
[0024] The specific method is:
[0025] According to Clontech's PCR-select TM The method shown in the cDNA Subtraction Kit kit manual was used to construct the SSH library (suppression subtraction library) by the suppression subtractive hybridization method. During the experiment, the mRNA extracted from the root of Salt-treated Lavenderia was used as the sample (Tester), and the mRNA extracted from the untreated Lamia root was used as the control (Driver). Specific steps are as follows:
[0026] (1) Test materials:
[0027] Mulan is collected from Futian National Nature Reserve (N22°53′, E114°01′) in Shenzhen, Guangdong Province. Hypocotyls of Bruguiera gymnorrhiza without pests, well-developed and similar in maturity were collected, and hypocotyls of similar size, length and weight were selected for the experiment. In plastic barrels (basin caliber 18cm, height 15cm), plastic trays are pla...
Embodiment 2
[0038] Cloning of the gene BgBADH encoding betaine dehydrogenase in embodiment 2
[0039] After removing the redundant DNA from the identified clone numbered Bg-SR-179 in the SSH library of Mulan, the sequence is SEQ ID No: 3. Sequence analysis shows that the protein encoded by this sequence belongs to betaine dehydrogenase. In this paper, the full-length coding gene corresponding to the sequence of SEQ ID No: 3 is named BgBADH, and the corresponding protein is named BADH.
[0040] SEQ ID No: 3:
[0041]
[0042] Cloning of the full-length coding gene of BgBADH
[0043] According to the obtained sequence of SEQ ID No: 3, the following two specific primers were designed as the 5' end specific primers of 3' RACE.
[0044] BgBADH GSP1: SEQ ID No: 4:
[0045] CAAGCTTGGC CCAGTTGTTG GT
[0046] BgBADH GSP2: SEQ ID No: 5:
[0047] TGCAAAAGAGTGAAGGTGCAA CTA
[0048] The experimental steps were operated according to the instructions of the kit (the 3'RACE System for Rapid Ampl...
Embodiment 3
[0083] Example 3 BgBADH Gene Plant Expression Vector Construction
[0084] The plant binary expression vector pCAMBIA2300 (purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd.) was selected as the plant expression vector, and the 35S promoter of the NPTII gene containing double enhancers was replaced with the Pnos promoter to reduce the expression of NPTII protein in plants . The 35S promoter and the Tnos terminator were selected as the promoter and terminator of the BgBADH gene respectively, and the construction flow chart is shown in Figure 1.
[0085] Primers SEQ ID NO: 12 and SEQ ID NO: 13 were used to amplify Pnos with the plant expression vector pBI121 plasmid (purchased from Beijing Huaxia Ocean Technology Co., Ltd.) as a template, and PrimeSTAR HS DNA polymerase of TAKARA was used. 50 μl PCR reaction system: 10 μl 5×PS Buffer, 3 μl 2.5 mM dNTP, 1.0 μl pBI121 plasmid, 1.0 μl PrimeSTAR HS DNA polymerase, 10 μM primers SEQ ID NO: 12 and 2.0 μl each of SEQ ID...
PUM
Property | Measurement | Unit |
---|---|---|
particle size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com