Method for adjusting mitochondrial gene expression by using small RNA and application thereof
A mitochondrial gene and gene expression technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, cells modified by introducing foreign genetic material, etc., can solve the problems that miRNA is impossible, impossible to regulate mitochondrial genes, etc., and achieve enhanced expression and translation horizontal effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Design of siRNA against mouse mitochondrial ND1 gene.
[0026] ND1 siRNA: UUCCUAUGGAUCCGAGCAUCTT, GAUGCUCGGAUCCAUAGGAATT.
[0027] (1) Culture 1×10 6 Mouse embryonic fibroblasts (MEFs) (25 cm2 growth area) were grown to 95% density.
[0028] (2) Prepare ND1siRNA and control RNA (CtlRNA) (Shanghai Gemma Control RNA) transfection mixture according to the instructions of lipofectaminRNAimax (liposome), mix well and let stand for 20 minutes.
[0029] (3) Digest MEF cells with trypsin, spread the digested cells on a 24-well plate at a density of 30%, and add the transfection mixture in step (2). The transfected cells were placed in a 37°C carbon dioxide cell incubator and cultured continuously for 48 hours.
[0030] (4) Wash the cells twice with PBS (pH 7.4), then treat the cells with Trizol (Life Technologies) reagent for 5 minutes, extract RNA, and perform reverse transcription quantitative PCR.
[0031] The reverse transcription reaction conditions were standardized p...
Embodiment 2
[0039] Effects of transfection of miR-1 (UGGAAUGUAAAAGAAGUAUGUAU) in human cervical cancer cells on mitochondrial genes
[0040] (1) Culture 1×10 6 Human cervical cancer cells (HeLa) (growth area of 25 cm2) were grown to 100% density.
[0041] (2) Prepare miR-1 (the sequence of miR-1 was synthesized and purified at Takara Company as shown above) or control RNA (CtlRNA) transfection mixture according to the instructions of lipofectamin2000 (liposome), mix well and let stand for 20 minutes.
[0042](3) Digest HeLa cells with trypsin, spread the digested cells on a 24-well plate at a density of 30%, add the transfection mixture in step (2), and place the transfected cells in a 37°C carbon dioxide cell incubator for continuous Incubate for 48 hours.
[0043] (4) Wash the cells twice with PBS (pH 7.4), then treat the cells with Trizol (Life Technologies) reagent for 5 minutes, extract RNA, and perform reverse transcription quantitative PCR.
[0044] The reverse transcription r...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap