Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for adjusting mitochondrial gene expression by using small RNA and application thereof

A mitochondrial gene and gene expression technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, cells modified by introducing foreign genetic material, etc., can solve the problems that miRNA is impossible, impossible to regulate mitochondrial genes, etc., and achieve enhanced expression and translation horizontal effect

Active Publication Date: 2015-12-30
WUHAN UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The function of miRNA and siRNA in mitochondria has never been reported, because mitochondria is an organelle with a double membrane and has its own genetic system. Although miRNAs have been reported to exist in mitochondria, it is generally believed that miRNAs cannot present in mitochondria, and less likely to regulate expression of mitochondrial genes in mitochondria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for adjusting mitochondrial gene expression by using small RNA and application thereof
  • Method for adjusting mitochondrial gene expression by using small RNA and application thereof
  • Method for adjusting mitochondrial gene expression by using small RNA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Design of siRNA against mouse mitochondrial ND1 gene.

[0026] ND1 siRNA: UUCCUAUGGAUCCGAGCAUCTT, GAUGCUCGGAUCCAUAGGAATT.

[0027] (1) Culture 1×10 6 Mouse embryonic fibroblasts (MEFs) (25 cm2 growth area) were grown to 95% density.

[0028] (2) Prepare ND1siRNA and control RNA (CtlRNA) (Shanghai Gemma Control RNA) transfection mixture according to the instructions of lipofectaminRNAimax (liposome), mix well and let stand for 20 minutes.

[0029] (3) Digest MEF cells with trypsin, spread the digested cells on a 24-well plate at a density of 30%, and add the transfection mixture in step (2). The transfected cells were placed in a 37°C carbon dioxide cell incubator and cultured continuously for 48 hours.

[0030] (4) Wash the cells twice with PBS (pH 7.4), then treat the cells with Trizol (Life Technologies) reagent for 5 minutes, extract RNA, and perform reverse transcription quantitative PCR.

[0031] The reverse transcription reaction conditions were standardized p...

Embodiment 2

[0039] Effects of transfection of miR-1 (UGGAAUGUAAAAGAAGUAUGUAU) in human cervical cancer cells on mitochondrial genes

[0040] (1) Culture 1×10 6 Human cervical cancer cells (HeLa) (growth area of ​​25 cm2) were grown to 100% density.

[0041] (2) Prepare miR-1 (the sequence of miR-1 was synthesized and purified at Takara Company as shown above) or control RNA (CtlRNA) transfection mixture according to the instructions of lipofectamin2000 (liposome), mix well and let stand for 20 minutes.

[0042](3) Digest HeLa cells with trypsin, spread the digested cells on a 24-well plate at a density of 30%, add the transfection mixture in step (2), and place the transfected cells in a 37°C carbon dioxide cell incubator for continuous Incubate for 48 hours.

[0043] (4) Wash the cells twice with PBS (pH 7.4), then treat the cells with Trizol (Life Technologies) reagent for 5 minutes, extract RNA, and perform reverse transcription quantitative PCR.

[0044] The reverse transcription r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for adjusting mitochondrial gene expression by using small RNA and application thereof. Adjustment of the mitochondrial gene expression can be realized by transfecting siRNA or miRNA into cells. Through the method, the functions of a mitochondrial gene and a mitochondrion adjusting function can be researched. By transferring the siRNA of a mitochondrial target gene into cells, the abundance degree of the mRNA of the target gene in the mitochondrion can be reduced and the protein level expression is reduced. The expression and translation levels of the target gene can be enhanced by the miRNA under the condition of not changing the mRNA level of the target gene in the mitochondrion and the function of the mitochondrion is adjusted. According to the invention, an adjusting effect of the miRNA on the mitochondrial gene is found firstly and a new direction is provided for research on the functions of the mitochondrial gene.

Description

technical field [0001] The technology relates to molecular biology, cell biology and biochemistry, and specifically relates to a method and application of using small RNA to regulate mitochondrial gene expression. Background technique [0002] Mitochondria in eukaryotes is a semi-autonomous organelle with its own unique genetic system, the mitochondrial double-stranded closed circular DNA, and DNA replication, transcription, and protein translation systems. Mitochondrial gene replication, transcription and translation have been studied for 35 years. Although some progress has been made in the field, understanding of mitochondrial inheritance and gene expression is only the tip of the iceberg. [0003] In addition, it is quite difficult to understand the function of specific genes in mitochondria, because mitochondria are organelles with a double-membrane structure, and the outer and inner membranes of mitochondria are highly selective for the exchange of molecules within the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N5/10
Inventor 张晓荣付向东
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com