System and application for rapid analysis of RNA functional elements in vivo

A functional element and rapid analysis technology, applied in the field of genetic engineering, can solve problems such as the inability to quickly find mRNA cis-acting elements

Inactive Publication Date: 2019-01-18
PEKING UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a system for rapid analysis of RNA functional elements in vivo, to solve the problem that in the prior art, it is impossible to quickly find functional cis-acting elements in the mRNA 3'UTR in plants, and to detect internal and external signals and effector proteins Problems with regulation of cis-acting elements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • System and application for rapid analysis of RNA functional elements in vivo
  • System and application for rapid analysis of RNA functional elements in vivo
  • System and application for rapid analysis of RNA functional elements in vivo

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] This embodiment provides a system for rapid analysis of RNA functional elements in vivo, for figure 1 The pCAMBIA2300-35S-OCS vector shown is transformed, and its resistance gene NPTII is excised with the restriction endonuclease XhoI, and connected into the mCherry fluorescent protein gene; in the multi-cloning site, there are two restriction sites of KpnI and XbaI The GFP fluorescent protein gene is interlinked, so that the two fluorescent proteins are driven by two different 35S strong promoters on the same carrier, forming a dual fluorescent reporter carrier, named pCAMBIA2335mG, referred to as p35mG, such as figure 2 shown.

[0031] The specific method of constructing the vector is as follows:

[0032] 1. Primers

[0033] Amplify mCherry:

[0034] forward primer

[0035] tctctcgagctttcgcagatctgtcgatcgaccatggtgagcaagggcgaggaggataacatggccatcatcaaggagttc

[0036] reverse primer agcctcgagtcacttgtacagctcgtccatgccgccggtggag

[0037] Amplified GFP:

[0038] Forwar...

Embodiment 2

[0087] This example provides a system for rapid analysis of RNA functional elements in vivo, which can accurately identify fragments that respond to ethylene signals and mediate translation inhibition.

[0088] The classic ethylene response is the well-known triple reaction, which is manifested in that when ethylene is applied, the etiolated seedlings show shorter and thicker hypocotyls, shorter roots, and intensified apical hooks. Previous studies found that the transgenic plants (G1U) overexpressing the full-length 3'UTR of EBF1 grown for 3 days on the medium containing 10 μM ACC (a precursor of ethylene biosynthesis) had obvious ethylene insensitivity. type, its hypocotyl length and root length are significantly longer than the wild type, and the top hook disappears, which has been disclosed in Chinese Patent No. ZL 201110110101.0.

[0089] Similarly, when we overexpress the above-mentioned fragments proved to have translation inhibition function by the detection system of ...

Embodiment 3

[0094]This embodiment provides a system for rapid analysis of RNA functional elements in vivo, which can detect the inhibitory effect of effector proteins on RNA translation.

[0095] The system provided in this example for rapid analysis of RNA functional elements in vivo can detect fragments that respond to ethylene signals and mediate translational repression, and the conclusions drawn are consistent with the phenotype of overexpressed 3'UTR fragments in Arabidopsis thaliana. Therefore, this system can be widely used in rapid analysis of RNA functional elements in plants, and can detect the regulation of different signals on 3'UTR.

[0096] In the tobacco transient expression system of this example, multiple Agrobacteria containing different plasmids can be transformed simultaneously, so this system can also be used to study the regulation of effector proteins on RNA. EIN5 (Ethylele Insensitive5, Potuschak et al., Plant Cell, 2006; Olmedo et al., PNAS, 2006) is known as a P...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a system for rapidly analyzing an RNA (ribonucleic acid) functional element in vivo. The system comprises a bifluorescence reporter vector p35mG, and the vector comprises a coding sequence shown as SEQ ID No.1. Through establishment of the bifluorescence reporter vector p35mG with the coding sequence shown as the SEQ ID No.1, one fluorescent protein mCherry is taken as internal reference, the other fluorescent protein GFP is taken as a reporter gene, a to-be-detected gene segment is inserted into GFP coding sequence to form a recombinant reporter gene GFP-3'UTR, and the functional cis acting element in the RNA is rapidly identified by analyzing influence of different segments on fluorescence intensity ratio of GFP to mCherry; besides, the regulation process of the cis acting element can be controlled through application of different treatment or expression of different effector proteins, and accordingly, the regulation effect of different signals or effector proteins in plants on the RNA is studied.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a system for rapidly analyzing RNA functional elements in vivo. Background technique [0002] There are a variety of regulatory elements on the 3'UTR (3'Un-Translated Region) of eukaryotic mRNA, which can specifically recruit various miRNAs and RNA-binding proteins, thereby regulating mRNA degradation, translation and subcellular localization (Chatterjee et al. al., Biology of the Cell, 2009; Mayr and Bartel, Cell, 2009; Szostak and Gebauer., Briefings in Functional Genomics, 2012). The 3'UTR of eukaryotic mRNA is generally a long sequence, and those functional regulatory elements are hidden in it. At present, scientific research still lacks a system for efficient and convenient analysis of functional elements in the mRNA 3'UTR . [0003] Some researchers transferred a vector into human cells, using bidirectional promoters to respectively initiate the gene transcrip...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/82C12Q1/6895
Inventor郭红卫马梦迪安丰英李文阳纪玉锶
OwnerPEKING UNIV