Manganese oxidation engineering bacterium for Escherichia coli and application of manganese oxidation engineering bacterium to environmental hormone degradation

A technology of Escherichia coli and environmental hormones, applied in the field of environmental remediation, can solve problems such as the persistence of toxic residual degradation effects, and achieve the effects of wide degradable substrates, improved thermal stability, and high practical value

Inactive Publication Date: 2016-02-03
HUAZHONG AGRI UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Utilizing the CotA protein laccase activity displayed on the surface of bacteria and the manganese oxide produced during the culture process to degrade environmental hormones and detoxify environmental hormones, it can solve the problems of toxic residues in the process of processing environmental hormones and the persistence of degradation effects, thereby to restore the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Manganese oxidation engineering bacterium for Escherichia coli and application of manganese oxidation engineering bacterium to environmental hormone degradation
  • Manganese oxidation engineering bacterium for Escherichia coli and application of manganese oxidation engineering bacterium to environmental hormone degradation
  • Manganese oxidation engineering bacterium for Escherichia coli and application of manganese oxidation engineering bacterium to environmental hormone degradation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] The cotA gene of spore coat protein was amplified in A56 manganese oxidizing strain, and the function of CotA protein was analyzed.

[0072] The applicant has isolated Bacillus A56 with high manganese oxidation activity in the laboratory, from which the cotA gene is amplified. The gene of cotA in A56 has a total of 1530bp, and its sequence is shown in SEQ ID NO.1.

[0073] Using DNAMAN to analyze the CotA amino acid sequence of A56, CotA is composed of 509 amino acids, the protein molecular weight is 58.6kDa, and the isoelectric point is 6.12. The amino acid sequence was analyzed by NCBI for the conserved domain, and the results showed that CotA contains three conserved copper ion binding sites, which are similar to the subunit domain of cytochrome C oxidase, and are the same as a variety of multi-copper oxidases. source. CotA is thus a multi-copper oxidase. And it does not contain signal peptide sequence and transmembrane structural threshold.

[0074] Comparing th...

Embodiment 2

[0076] The construction of Escherichia coli manganese oxidizing engineering bacteria, the steps are as follows:

[0077] The cotA gene of the A56 bacterial strain was artificially synthesized, and the gene sequence was shown in SEQIDNO.1. The cotA fragment and the plasmid pMB102 (pTrcHisC-inaQN-gfp) (Improved phosphate biosorption by bacterial surface display of phosphate-bindingproteinutilizingicenucleationprotein.FEMSMicrobiolLett2009, 299, (1), 44-52) were restricted by Endonucleases BamHI and EcoRI were used to digest, and the required fragments were recovered, and enzyme-ligated under the action of T4 ligase to obtain recombinant plasmid pMB500, such as figure 2 , pMB500 was transformed into Escherichia coli DH5α, and the transformants were subjected to rapid detection and PCR amplification verification, PCR amplification of inaQ-N (inpN1, TGCCATGGATCTCGAVAAGGCGTTGGTGC; inpN2, TAAGATCTGGTCTGCAAATTCTGCGGCGTCG) and cotA gene (cotF2, 5'GCGTCG) respectively GGATCC ATGAACCTAG...

Embodiment 3

[0090] The preparation method of MB500 genetically engineered bacteria:

[0091] Use LB medium to subculture the recombinant bacteria (1LLB medium: 5 g of yeast extract, 10 g of tryptone, 10 g of sodium chloride, pH 7.0-7.2.). Pick a single colony and inoculate it into a 5ml PA bottle containing LB medium, and culture overnight at 37°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a manganese oxidation engineering bacterium for Escherichia coli and application of the manganese oxidation engineering bacterium to environmental hormone degradation. The manganese oxidation engineering bacterium and the application have the advantages that gene engineering strains of surface display spore coat proteins CotA of the Escherichia coli Top10 are constructed, accordingly, the engineering bacterium for the Escherichia coli has manganese oxidation activity, Mn2+ can be oxidized by the engineering strains to obtain high-valence manganese ions, the gene engineering strains are stable in manganese oxidation activity, generated manganese oxide is MnO2, MnCO3 and KMnO4, environmental hormones can be quickly and completely degraded by thallus and manganese oxide mixed systems, and the toxicity of degradation products can disappear; the strains and the mixed systems generated by the strains can be used in the field of environmental remediation and the like.

Description

technical field [0001] The invention relates to the field of applied microorganism technology and the field of environmental restoration, in particular to an Escherichia coli manganese oxidizing engineering bacterium, and also relates to the application of the genetic engineering bacterium in degradation of environmental hormones. Background technique [0002] Many kinds of microorganisms can quickly oxidize Mn(II) into manganese oxides. Compared with chemically synthesized manganese oxide minerals, biological manganese oxides have weak crystallization, small particle size, high valence, many octahedral holes in the structure, and large specific surface area. Compared with chemically synthesized manganese oxides, it has stronger adsorption, oxidation and photoreduction dissolution properties. Biological manganese oxides can adsorb a variety of heavy metals, oxidize low-valent heavy metal ions, and degrade organic pollutants such as ethinyl estradiol, which has broad applicati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N15/70C12N1/21A62D3/02C12R1/19A62D101/28
Inventor李林张震刘瑾
OwnerHUAZHONG AGRI UNIV