Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for synthesizing fatty alcohol acetic acid ester in microorganism

A microbial synthesis, alcohol acetate technology, applied in the field of microbial genetic engineering, can solve the problem of high synthesis cost, achieve the effects of fast growth, reduced release, and mature genetic manipulation technology

Active Publication Date: 2016-02-17
GANNAN NORMAL UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The chemical synthesis of sex pheromones involves multiple reaction steps, resulting in high synthesis costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthesizing fatty alcohol acetic acid ester in microorganism
  • Method for synthesizing fatty alcohol acetic acid ester in microorganism
  • Method for synthesizing fatty alcohol acetic acid ester in microorganism

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1 is based on fatty acyl ACP as the precursor molecule to produce fatty alcohol acetate Escherichia coli engineering bacteria (figure 1 shown)

[0025] A) Construction of Fatty Alcohol-Producing Engineering Bacteria

[0026] 1. Using primers AAR-XbaI (GTATCTAGAAAGAGGAGATATAATGTTCGGTCTTATCGGTCATCTC) and AAR-SpeI-BamHI (TGTGGATCCACTAGTTCAAATTGCCAATGCCAAGG) PCR amplification from Synechococcuse longates The AAR gene of bacteria, and then the amplified fragment is wxya with BamHI Insertion into pET28a(+) resulted in vector pDY01. Using primers AHR-XbaI (ATATCTAGAAAGAGGAGATATAATGTCGATGATAAAAAAGCTATGCCG) and AHR-SpeI-BamHI (GTAGGATCCACTAGTTCAAAAATCGGCTTTCAACACCAC) to PCR amplify the AHR gene from Escherichia coli, using wxya with BamHI Insertion into pET28a(+) resulted in vector pDY02. The AAR expression cassette was obtained by double-digesting pDY01 with XbaI and XhoI, and inserted into the vector pDY02 double-digested with SpeI and XhoI to obtain the r...

Embodiment 2

[0031] Embodiment 2 is based on the construction of fatty acid as a precursor molecule to produce fatty alcohol acetate Escherichia coli engineering bacteria ( figure 1 shown)

[0032] A) Construction of Fatty Alcohol-Producing Engineering Bacteria

[0033] 1、 Using primers CAR-XbaI (ATATCTAGAAAGAGGAGATATAATGTCGCCAATCACGCGTGA) and AAR-SpeI-BamHI (AGAGGATCCACTAGTTCAGAGCAGGCCGAGTAGGC) PCR amplification from Mycobacterium marinum The CAR gene of bacteria, and then the amplified fragment was wxya with BamHI Insertion into pET28a(+) resulted in vector pDY06. The 'TesA gene from Escherichia coli was amplified by PCR with primers 'TesA-SacI (AGATGAGCTCATGGCGGACACGTTATTGATTCTGG) and 'TesA-SpeI (TGTACTAGTTTATGAGTCATGATTTACTAAAGGCTGC), and then the amplified fragment was double-digested with SacI and SpeI and inserted into pBBR1MCS1 to obtain vector pDY07. The AHR gene from Escherichia coli was amplified by PCR using primers AHR-BamHI (ACTGGATCCAAGAAGGAGATATAATGTCGATGATAAAAAAGCT...

Embodiment 3

[0038] Example 3 Construction of Escherichia coli Engineering Bacteria Based on Fatty ACP and Fatty Acyl-CoA as Precursor Molecules to Produce Fatty Alcohol Acetate ( figure 1 shown)

[0039] A) Construction of Fatty Alcohol-Producing Engineering Bacteria

[0040] 1、 Using primers FAR-XbaI (CAATCTAGAAAGAGGAGATATAATGGCAATACAGCAGGTACATCAC) and FAR-SpeI-BamHI (CGAGGATCCACTAGTTCAGGCAGCTTTTTTGCGCT) PCR amplification from M. aquaolei Bacteria's FAR gene, and then the amplified fragment was wxya with BamHI Insertion into pET28a(+) resulted in vector pDY11.

[0041] 2. The recombinant vector pDY11 was introduced into Escherichia coli GM1655 to obtain GDY5 engineering bacteria. The engineering bacterium realizes the high expression of the FAR gene. The FAR enzyme was expressed to catalyze the direct reduction of fatty acid synthesis intermediates acyl-ACP and acyl-CoA to fatty alcohols.

[0042] B) Construction of Fatty Alcohol Acetate Engineering Bacteria

[0043] 1、 The v...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for synthesizing pheromone fatty alcohol acetic acid ester in a microorganism, based on a fatty acid metabolic pathway and by using three intermediate products as precursor molecules. The method includes: highly expressing acyl-ACP reductase AAR, carboxylic acid reductase CAR, acyl-CoA reductase FAR and aldehyde reductase AHR in the microorganism to respectively obtain engineering bacteria capable of reducing acyl-ACP, fatty acid or acyl-CoA fat generating alcohol; highly expressing alcohol acetyltransferase ATF1 in the fat-generating alcohol engineering bacteria to catalyze reaction of fatty alcohol and acetyl coenzyme A to synthesize the pheromone fatty alcohol acetic acid ester. By the method, microbial conversion from glucose to the fatty alcohol acetic acid ester can be realized, and a feasible way is provided for biologically synthesizing the fatty alcohol acetic acid ester on a large scale.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, and in particular relates to a method for directly synthesizing pheromone fatty alcohol acetate from monosaccharide by transforming microbial metabolic pathway. Background technique [0002] 1. Insect sex pheromones, also known as sex pheromones (artificially synthesized and used to control pests, are also called sex attractants), are secreted in vitro by special organs of a certain sex of the same insect, and can be absorbed by individuals of the same sex. Trace chemical substances that are accepted by the receptors and cause corresponding behavioral responses or physiological effects (such as mate seeking, directional courtship, mating, etc.). So far, about 2000 kinds of insect sex pheromones have been identified, most of which are various fatty alcohol acetate molecules. At present, a few insect sex pheromones have been chemically synthesized. Since the application of insect pher...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P7/64C12R1/19
CPCY02E50/10
Inventor 郭道义潘虹李勋李永东范小林
Owner GANNAN NORMAL UNIV