Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Apostichopus japonicus lectin gene, recombinant fusion protein and preparation method

A technology of fusion protein and japonicus imitation, applied in the field of marine biological genetic engineering, can solve the problems of complex natural sea cucumber lectin process and high cost, and achieve the effects of inhibiting sea cucumber diseases, low cost, and reducing pollution

Inactive Publication Date: 2016-02-24
DALIAN OCEAN UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the process of isolating and extracting natural sea cucumber lectin is complicated and costly. So far, there are no related reports on the recombinant A. japonicus lectin gene, encoded protein and preparation method.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Apostichopus japonicus lectin gene, recombinant fusion protein and preparation method
  • Apostichopus japonicus lectin gene, recombinant fusion protein and preparation method
  • Apostichopus japonicus lectin gene, recombinant fusion protein and preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0024] a. Extract the total RNA of sea cucumber:

[0025] Take 100mg of the body wall of sea cucumber, grind it with liquid nitrogen, add 1ml TRNzol–A + Extraction reagent (TIANGEN), and other specific operations are based on TRNzol-A of TIANGEN company + Instructions for total RNA extraction reagents were included.

[0026] b. The total RNA of A. japonicus was reverse transcribed to synthesize 3'-RACE-Ready cDNA and 5'-RACE-Ready cDNA.

[0027] c. Using 3'-RACE-Ready cDNA as template, carry out PCR reaction with specific primer Ajmbcl-3 and UPM, obtain 3'-FirstroundPCR product, and described specific primer Ajmbcl-3 sequence is as follows:

[0028] Ajmbcl-3: 5'GGACTGGCTTCAATGGAAAGTGTTA3'.

[0029] d. Using the 3'-Firstround PCR product as a template, carry out a PCR reaction with specific primers Ajmbcl-n3 and NUP to obtain a 3'-NET-PCR product. The specific primer Ajmbcl-n3 sequence is as follows:

[0030] Ajmbcl-n3: 5'ACAGTCGCGGGGCCATAGCATCGGG3';

[0031] Obtaining the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Apostichopus japonicus lectin gene. A nucleotide sequence of the gene is shown as SEQ ID NO:1, and an amino acid sequence of recombinant fusion protein of the gene is shown as SEQ ID NO:2. The preparation method of the gene includes: extracting Apostichopus japonicus body wall total RNA; synthesizing a first strand of cDNA; using cDNA as a template to respectively obtain 5'RACE and 3'RACE products; using a RT-PCR primer for amplification to obtain a complete lectin gene segment, and obtaining a complete lectin sequence through sequencing and splicing; connecting the lectin gene onto a PMD19-T vector, and subjecting a product to positive colon expression and purification to obtain the Apostichopus japonicus lectin recombinant fusion protein rAj-MBCL. The preparation method is simple and high in purification rate, and the obtained Apostichopus japonicus lectin recombinant fusion protein is low in cost, high in agglutinating activity, high in expression quantity, small in experiment repeated difference, stable in result and high in controllability.

Description

technical field [0001] The invention belongs to the field of marine biological genetic engineering, and in particular relates to a japonicus japonicus lectin gene, a recombinant fusion protein and a preparation method. Background technique [0002] There are more than 1,200 species of sea cucumbers belonging to the class of echinoderms, and there are more than 140 species distributed in my country's sea areas. Among them, the ones with the best quality and highest medicinal value are the North Pacific coastal imitation species produced in Liaoning, Shandong, Hebei and other places in China. sea ​​cucumber ( Apostichopus japonicus ). In recent years, sea cucumber has become an important ecological and economic species in East Asia and Southeast Asia, and the sea cucumber aquaculture industry in the northern coastal areas of China has also developed rapidly. However, due to the high concentration of pathogenic bacteria in the ocean, serious disease problems in sea cucumber fa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/10C07K19/00
Inventor 王秀利薛壮李慧周玮仇雪梅
Owner DALIAN OCEAN UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More