Apostichopus japonicus lectin gene, recombinant fusion protein and preparation method
A technology of fusion protein and japonicus imitation, applied in the field of marine biological genetic engineering, can solve the problems of complex natural sea cucumber lectin process and high cost, and achieve the effects of inhibiting sea cucumber diseases, low cost, and reducing pollution
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0024] a. Extract the total RNA of sea cucumber:
[0025] Take 100mg of the body wall of sea cucumber, grind it with liquid nitrogen, add 1ml TRNzol–A + Extraction reagent (TIANGEN), and other specific operations are based on TRNzol-A of TIANGEN company + Instructions for total RNA extraction reagents were included.
[0026] b. The total RNA of A. japonicus was reverse transcribed to synthesize 3'-RACE-Ready cDNA and 5'-RACE-Ready cDNA.
[0027] c. Using 3'-RACE-Ready cDNA as template, carry out PCR reaction with specific primer Ajmbcl-3 and UPM, obtain 3'-FirstroundPCR product, and described specific primer Ajmbcl-3 sequence is as follows:
[0028] Ajmbcl-3: 5'GGACTGGCTTCAATGGAAAGTGTTA3'.
[0029] d. Using the 3'-Firstround PCR product as a template, carry out a PCR reaction with specific primers Ajmbcl-n3 and NUP to obtain a 3'-NET-PCR product. The specific primer Ajmbcl-n3 sequence is as follows:
[0030] Ajmbcl-n3: 5'ACAGTCGCGGGGCCATAGCATCGGG3';
[0031] Obtaining the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 