Method of improving fermentation cell density using hemoglobin
A technology of hemoglobin and cells, applied in the biological field, can solve the problems of decreased oxygen utilization efficiency and unfavorable growth of high-density cells, and achieve the effects of increasing the number and density of growth, improving utilization rate, and reducing losses
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0090] Embodiment 1, increase fermentation unit cell density by intracellular expression of VHb hemoglobin gene
[0091] 1. Construction of engineering bacteria
[0092] 1. Construction of expression vector pSEVA331-Pporin+vgb
[0093] 1), the acquisition of the target promoter Pporin
[0094] Extract the genome of Halomonas TD01 (Halomonas TD01, now preserved in the Culture Collection Center of the Institute of Microbiology, Chinese Academy of Sciences, with the preservation number CGMCC4353; the patent publication number CN102816729A) as a template, with G-Pporin-1TF and G-Pporin-2TR as primers , PCR amplification with pfu enzyme.
[0095] Primers are:
[0096] G-Pporin-1TF: 5'gataacaatttcacacaggacggccgctgagacctgccag3'
[0097] G-Pporin-2TR: 5'ctcctctttctctagtaaagtctgcagctggcttgc3'
[0098] PCR reaction conditions:
[0099]Pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 30 seconds, 30 ...
Embodiment 2
[0159] Example 2, through the expression of the VHb hemoglobin gene in the periplasmic space to increase the cell density of the fermentation unit
[0160] 1. Construction of engineering bacteria
[0161] 1. Construction of expression vector pSEVA331-Pporin+Tat-vgb
[0162] 1), the acquisition of the target gene Pporin
[0163] The genome of Halomonas TD01 (Halomonas TD01) was extracted as a template, G-Pporin-1TF and G-Pporin-2TR were used as primers, and PCR amplification was performed with Pfu enzyme.
[0164] Primers are:
[0165] G-Pporin-1TF: 5'gataacaatttcacacaggacggccgctgagacctgccag3'
[0166] G-Pporin-2TR: 5'ctcctctttctctagtaaagtctgcagctggcttgc3'
[0167] The PCR product of 218bp was obtained, which was the target gene Pporin, and its nucleotide sequence was the 33rd-250th position from the 5' end of sequence 2 in the sequence listing.
[0168] 2), the acquisition of the target gene tat
[0169] The genome of Escherichia coli K-12 line JM109SG was extracted as a...
Embodiment 3
[0357] Example 3, Increase the cell density of the fermentation unit by displaying hemoglobin on the cell surface
[0358] 1. Construction of engineering bacteria
[0359] 1. Construction of expression vector pSEVA331-PporinTat-vgb-Ag43
[0360] 1), the acquisition of the target gene Pporin
[0361] The genome of Halomonas TD01 (Halomonas TD01) was extracted as a template, G-Pporin-1TF and G-Pporin-2TR were used as primers, and PCR amplification was performed with pfu enzyme.
[0362] Primers are:
[0363] G-Pporin-1TF: 5'gataacaatttcacacaggacggccgctgagacctgccag3'
[0364] G-Pporin-2TR: 5'ctcctctttctctagtaaagtctgcagctggcttgc3'
[0365] The PCR product of 218bp was obtained, which was the target gene Pporin, and its nucleotide sequence was the 33rd-250th position from the 5' end of sequence 7 in the sequence listing.
[0366] 2), the acquisition of the target gene tat
[0367] The genome of Escherichia coli K-12 line JM109SG was extracted as a template, G-tat-1TF and G-ta...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com