Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Omega-3 desaturase from Phytophthora nicotianae, vector containing desaturase, recombinant microorganism and their application

A technology for recombining microorganisms and Phytophthora parasitica, applied in the field of bioengineering

Active Publication Date: 2016-03-02
JIANGNAN UNIV
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These three enzymes can catalyze both 18C and 20C polyunsaturated fatty acids, but prefer to catalyze the 20C substrate ARA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Omega-3 desaturase from Phytophthora nicotianae, vector containing desaturase, recombinant microorganism and their application
  • Omega-3 desaturase from Phytophthora nicotianae, vector containing desaturase, recombinant microorganism and their application
  • Omega-3 desaturase from Phytophthora nicotianae, vector containing desaturase, recombinant microorganism and their application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Determination of an omega-3 desaturase with a normal temperature preference of 20C

[0026] Five known ω-3 desaturase sequences (genes OPIN17, sdd17, PsD17, PrD17 and PaD17) with a normal temperature preference of 20C were compared in the NCBI library, and two were screened out based on sequence similarity and homology analysis. The ω-3 desaturase gene sequences with high similarity and close relationship with the known sequences are from Phytophthora parasitica and Aphanomyces mediatedus respectively, and the corresponding gene numbers are XM_008906963 and XM_008870610 respectively. The annotations of these two sequences in the NCBI library belong to the family of fatty acid desaturases, but their specific functions have not been annotated in detail.

[0027] By ClustalW2 software, the above two sequences of the coding regions of the genes were compared with the aforementioned five known 20C-preferring ω-3 desaturase sequences, and it was found that the abov...

Embodiment 2

[0030]Embodiment 2: Construction of recombinant expression vector

[0031] 1. Obtain the target gene

[0032] Since the codon usage bias of the gene sequences derived from Phytophthora parasitica, Aphanomyces meloni and Pythium melonica is different from that of the host Saccharomyces cerevisiae, according to the codon usage bias of eukaryotes, the nucleic acid sequences were analyzed using the GenscriptOptimumGeneTMsystem Codon optimization, artificially synthesized optimized gene sequences oPpFADS17, oAiFADS17 and oPaFADS17 (as positive controls), such as SEQIDNO. PUC57-oAiFADS17 and PUC57-oPaFADS17 were stored in Escherichia coli Top10 (purchased from GenScript, Nanjing, China).

[0033] Primers were designed according to the sequences of oPpFADS17, oAiFADS17 and oPaFADS17, and restriction sites EcoRI and XhoI (underlined) were added to each pair of primers. Using the plasmids PUC57-oPpFADS17, PUC57-oAiFADS17, and PUC57-oPaFADS17 respectively containing the above optimize...

experiment example 4

[0062] Experimental Example 4, PCR verification of Saccharomyces cerevisiae transformants

[0063] Pick the well-growth colony from the plate and inoculate it into 5mL YPD medium containing ampicillin resistance, culture at 200rpm at 30°C for 48h, extract the plasmid with a plasmid extraction kit (purchased from Tiangen Company), and measure A260nm and A280nm value, calculate the concentration of the plasmid, and store at low temperature.

[0064] The corresponding primers were used for PCR identification. Primers are as follows:

[0065] T7TAATACGACTCACTATAGGG

[0066] T7terminatorTCGGTTAGAGCGGATGTG

[0067] The PCR reaction system is as follows: ddH 2 O7 μL, 10×TaqMIX 10 μL, universal primer T71 μL, universal primer T7terminator 1 μL, template (plasmid) 1 μL. PCR reaction conditions: 94°C for 5min, 94°C for 30s, 58°C for 30s, 72°C for 1.5min, 30 cycles, 72°C for 7min. After the amplification reaction, take 3 μL of the PCR product and perform 1wt% agarose gel electropho...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant nucleotide sequence as shown in SEQ ID NO. 3 and used for encoding Omega-3 desaturase from Phytophthora nicotianae, a vector containing the Omega-3 desaturase, and a recombinant microorganism containing the vector, in particular recombinant Saccharomyces cerevisiae and also relates to a construction method of the recombinant Saccharomyces cerevisiae as well as application of the Saccharomyces cerevisiae containing the desaturase in the biological synthesis of polyunsaturated fatty acids. The Saccharomyces cerevisiae can catalyze C20:4<Delta5,8,11,14> into C20:5<Delta5,8,11,14,17> at normal temperature, with catalytic efficiency up to 65%.

Description

【Technical field】 [0001] The invention belongs to the technical field of bioengineering, and relates to the synthesis of polyunsaturated fatty acids by microorganisms, in particular to an ω-3 desaturase for synthesizing polyunsaturated fatty acids, a carrier containing the ω-3 desaturase, and a carrier containing the ω-3 desaturase. Recombinant microorganisms with the above-mentioned vectors and their applications. 【Background technique】 [0002] Long-chain polyunsaturated fatty acids (LC-PUFAs) refer to polyunsaturated fatty acids containing 20 or more carbon atoms, which can be divided into ω-6 and ω-3 according to the position of the first double bond from the C-terminus . Omega-3LC-PUFAs cannot be synthesized by the human body and need to be obtained from the diet. They are essential fatty acids, such as EPA and DHA. Studies have found that ω-3LC-PUFAs represented by EPA and DHA can be used as precursors for the synthesis of certain hormones, and have multiple physiolo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/53C12N15/81C12N1/19C12N9/02C12P7/64C12R1/865
Inventor 陈海琴陈永泉陈卫梅甜甜顾震南张灏
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com