A detection kit and detection method utilizing antibody modified immune PCR reaction

A technology of antibody modification and kit, which is applied in the field of immunological detection, can solve the problems of decreased antibody specificity and affinity, difficult to break through 1000 times of sensitivity, and varying degrees of improvement, and achieve broad detection sensitivity, wide dynamic range, and simplified detection The effect of the process

Active Publication Date: 2019-02-12
PIXEL BIOSCIENCES (SUZHOU) CO LTD
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This coupling technology not only requires the antibody to be coupled in an inactive buffer, but also the coupling site is full of randomness, often due to the shielding of the coupled DNA near the antigen-antibody binding region, resulting in a lack of antibody specificity and drop in affinity
This is also the reason why the sensitivity of Immuno-PCR has been difficult to break through 1000 times in examples over the years and the degree of improvement varies.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A detection kit and detection method utilizing antibody modified immune PCR reaction
  • A detection kit and detection method utilizing antibody modified immune PCR reaction
  • A detection kit and detection method utilizing antibody modified immune PCR reaction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1: Biotin Modification of Insulin Antibody 3A6

[0069] The Insulin monoclonal antibody 3A6 (ab1965) from Abcam needs to be biotin-modified before it can be specifically coated on a streptavidin PCR 96well microwell plate (Pierce, Cat No.15500) for Immuno- PCR detection. The antibody was modified using the SiteClick series labeling kit (S10467) and DIBO-labeled biotin (C10412) from Life Technologies.

[0070] (1) Purification and modification of antibodies are carried out first.

[0071] The first round of purification: first add 0.5mg / ml 250μL 3A6 antibody solution to the antibody concentrator (an ultrafiltration centrifuge tube with unknown molecular weight cut-off) attached to the kit, which can concentrate the antibody and replace the buffer Add 500 μL of antibody replacement buffer (buffer A) to the concentrator and centrifuge at 4° C. for 5 minutes at 6000 × g. After the centrifugation is completed, use a pipette to absorb the remaining solution to clean...

Embodiment 2

[0076] Example 2: ssDNA modification of Insulin antibody

[0077] (1) Synthesis of ssDNA with DIBO marker (dibenzocyclooctyne):

[0078] a. Generate a random sequence with a length of 100bp through the DNA sequence random synthesis website (http: / / www.facμLty.ucr.edu / ~mmaduro / random.htm)

[0079] 5'-ATGGGGCTGGATAAAACTGCCCTGGTGACCGCCATCAACAACCCGAATACGTGGCATTTCAGGAGGCGGCCGGAGGGGGATGTTTTCTACTATTCGAGG-3' (SEQ ID No. 1).

[0080] Through the blastn search program (http: / / www.ncbi.nlm.nih.gov / BLAST / Blast.cgi), it was confirmed that the sequence does not have any known sequences homologous to it, so as to ensure that the subsequent PCR detection signal is specific information from antibody binding .

[0081] After determining the sequence of the ssDNA, the 5' terminal DIBO-marked ssDNA (SEQ ID No.1) and two PCR primers for amplifying the fragment were synthesized by IDT (www.idtdna.com):

[0082] 5'-ATGGGGCTGGATAAAACTGC-3' (SEQ ID No.2) and

[0083] 5'-CCTCGAATAGTAGAAAACATCCCC-3'...

Embodiment 3

[0091] Embodiment 3: the making of Insulin immune PCR standard curve

[0092] (1), Preparation of Immuno-PCR microwell plate:

[0093] The DIBO-labeled biotin-modified Insulin antibody 3A6 solution obtained in Example 1 was coated on a streptavidin PCR microwell plate (Pierce Company, Cat No. 15500): after overnight incubation for 12 hours at 4°C , the antibody-coated microplate was washed three times with PBST buffer (1×PBS, 0.1% Tween 20), and then washed with PBST-BSA buffer (1×PBS, 0.1% Tween 20, 5% BSA) at 4°C Incubate the microwell plate overnight, and then wash the microwell plate with PBST buffer three times for use to obtain an Immuno-PCR microwell plate.

[0094] (2), InsuLin Immuno-PCR standard curve formulation:

[0095] a, first prepare human source Insulin standard substance (mother solution, 10mg / mL, Sigma company), the concentration of standard substance is from 33ng / ml to 3.3x10E-5ng / ml 10-fold equal dilution, has 7 different concentrations altogether; Gradi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the field of immunological detection methods. A purpose of the present invention is to provide a detection kit and a detection method using antibody to modify an immuno-PCR reaction. The detection method comprises synthesis of DIBO-labeled ssDNA, biotin modification of Insulin monoclonal antibody, preparation of ssDNA-modified immuno-PCR micro-pore plate of Insulin monoclonal antibody, establishment of Immuno-PCR standard curve of Insulin, and other steps. According to the present invention, with the application of the antibody modification technology in the immuno-PCR reaction, the detection on the ultra low concentration biotin marker can be performed, the sensitivity of the detection method of the present invention can exceed 1000 times the sensitivity of the conventional ELISA method, and the extremely-low concentration biomarker can be detected.

Description

technical field [0001] The invention belongs to the field of immunological detection methods, and in particular relates to a detection kit and a detection method utilizing antibody modification for immuno-PCR reaction. Background technique [0002] ELISA detection technology has been more and more widely used in clinical and research markets since its invention (Lequin, R.M. (2005). Enzyme Immunoassay (EIA) / Enzyme-Linked Immunosorbent Assay (ELISA). Clinical Chemistry 51, 2415–2418.). With increasingly sophisticated detection requirements, end users have higher and higher requirements for in vitro diagnostic sensitivity, dynamic range, and multi-channel detection capabilities. Antibody-based detection technologies are becoming more and more diverse, and many new technologies have emerged. According to different technical routes and requirements, they are divided into the following categories: [0003] 1. Increased sensitivity. After years of technical upgrading and matur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68G01N33/68
Inventor程永升吴雪萍
OwnerPIXEL BIOSCIENCES (SUZHOU) CO LTD