Capture kit and method of target gene
A target gene and capture reagent technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc. Low cost, simple composition effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1: Specific probe sets for biotin-labeled target genes
[0058] 1) Design a 150nt specific probe sequence covering the target gene, such as the nucleotide sequence shown in SEQ ID NO.3-SEQ ID NO.1237, synthesized by a biological company (CustomArray, USA) for future use. The specific probe sequence is divided into three parts: 15nt universal linker A-120nt target gene specific sequence-15nt universal linker B, namely ATCGCACCAGCGTGT-120nt-CACTGCGGCTCCTCA
[0059] 2) Use PCR to enrich the content of the probe and connect to the T7 promoter: use TitaniumTaqPCRKit (Clontech)
[0060] The PCR system (50μL system) is:
[0061]
[0062] Primer C is: CTGGGAATCGCACCAGCGTGT
[0063] Primer D is: CGTGGATGAGGAGCCGCAGTG
[0064] Reaction cycle time: 94°C 2min
[0065] 19cycles: 94°C 30s; 55°C 30s; 72°C 30s
[0066] 72℃2min
[0067] The PCR product was purified using QiagenQIAquickPCRextrationKit, and the purified product was eluted with 25 μL kit (TitaniumTaqPCRKit...
Embodiment 2
[0080] Example 2: Capture kit for target gene
[0081] A target gene capture kit consists of the biotin-labeled target gene-specific probe set prepared in Example 1, hybridization mixture, hybridization buffer, washing solution A, washing solution B and eluent.
[0082] Wherein, the hybridization mixture: 500ng / μL human Cot-1 DNA and 500ng / μL salmon sperm DNA;
[0083] 2×hybridization buffer: 10×SSPE buffer, 10×Denhardt’s Solution, 10mM EDTA and 0.1% SDS;
[0084] Washing solution A: 1×SSC / 0.1%SDS;
[0085] Washing solution B: 0.1×SSC / 0.1%SDS;
[0086] Eluent: 0.1M NaOH.
Embodiment 3
[0088] A human whole blood sample genomic DNA library was constructed using the Illumina Standard Library Construction Kit, and 250 ng / μL of 200bp-350bp standard library fragments were obtained.
[0089]Preheat 5 μL of hybridization mixture and 2 μL of standard library fragments, 7 μL of the mixture, at 95°C for 5 minutes, keep at 65°C for 5 minutes, mix with 13 μL of 2-fold hybridization buffer preheated at 65°C, 6 μL of 500 ng biotin-labeled target Mix the gene-specific probe set and 20U RNase inhibitor SUPERRase-IN, keep it at 65°C for 16-18h, add 50μL streptavidin magnetic bead solution (M-280streptavidinDynabeads, Invitrogen), mix and let it stand for 30 minutes Finally, after absorbing the magnetic beads with a magnetic stand for 15 minutes, discard the supernatant, add 500 μL of washing solution A, mix well at room temperature, use a magnetic stand to absorb the magnetic beads for 15 minutes, and discard the supernatant. Add 500 μL of washing solution B at 65°C, mix wel...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap