Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Capture kit and method of target gene

A target gene and capture reagent technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc. Low cost, simple composition effect

Active Publication Date: 2016-04-27
ZHEJIANG UNIV +1
View PDF1 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Moreover, although the above commercial kits can achieve a coverage rate of more than 90%, there are still 10% areas missing, and the coverage depth of each area is different, so quantitative analysis cannot be performed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Capture kit and method of target gene
  • Capture kit and method of target gene
  • Capture kit and method of target gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1: Specific probe sets for biotin-labeled target genes

[0058] 1) Design a 150nt specific probe sequence covering the target gene, such as the nucleotide sequence shown in SEQ ID NO.3-SEQ ID NO.1237, synthesized by a biological company (CustomArray, USA) for future use. The specific probe sequence is divided into three parts: 15nt universal linker A-120nt target gene specific sequence-15nt universal linker B, namely ATCGCACCAGCGTGT-120nt-CACTGCGGCTCCTCA

[0059] 2) Use PCR to enrich the content of the probe and connect to the T7 promoter: use TitaniumTaqPCRKit (Clontech)

[0060] The PCR system (50μL system) is:

[0061]

[0062] Primer C is: CTGGGAATCGCACCAGCGTGT

[0063] Primer D is: CGTGGATGAGGAGCCGCAGTG

[0064] Reaction cycle time: 94°C 2min

[0065] 19cycles: 94°C 30s; 55°C 30s; 72°C 30s

[0066] 72℃2min

[0067] The PCR product was purified using QiagenQIAquickPCRextrationKit, and the purified product was eluted with 25 μL kit (TitaniumTaqPCRKit...

Embodiment 2

[0080] Example 2: Capture kit for target gene

[0081] A target gene capture kit consists of the biotin-labeled target gene-specific probe set prepared in Example 1, hybridization mixture, hybridization buffer, washing solution A, washing solution B and eluent.

[0082] Wherein, the hybridization mixture: 500ng / μL human Cot-1 DNA and 500ng / μL salmon sperm DNA;

[0083] 2×hybridization buffer: 10×SSPE buffer, 10×Denhardt’s Solution, 10mM EDTA and 0.1% SDS;

[0084] Washing solution A: 1×SSC / 0.1%SDS;

[0085] Washing solution B: 0.1×SSC / 0.1%SDS;

[0086] Eluent: 0.1M NaOH.

Embodiment 3

[0088] A human whole blood sample genomic DNA library was constructed using the Illumina Standard Library Construction Kit, and 250 ng / μL of 200bp-350bp standard library fragments were obtained.

[0089]Preheat 5 μL of hybridization mixture and 2 μL of standard library fragments, 7 μL of the mixture, at 95°C for 5 minutes, keep at 65°C for 5 minutes, mix with 13 μL of 2-fold hybridization buffer preheated at 65°C, 6 μL of 500 ng biotin-labeled target Mix the gene-specific probe set and 20U RNase inhibitor SUPERRase-IN, keep it at 65°C for 16-18h, add 50μL streptavidin magnetic bead solution (M-280streptavidinDynabeads, Invitrogen), mix and let it stand for 30 minutes Finally, after absorbing the magnetic beads with a magnetic stand for 15 minutes, discard the supernatant, add 500 μL of washing solution A, mix well at room temperature, use a magnetic stand to absorb the magnetic beads for 15 minutes, and discard the supernatant. Add 500 μL of washing solution B at 65°C, mix wel...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology and discloses a capture probe of a target gene, a capture kit comprising the capture probe of the target gene, and a method for capturing the target gene. The capture probe of the target gene includes a biotin-labeled 63-probe specific probe set for the target gene, the probe set is hybridized with genome-wide DNA, capturing DNA fragments combined with probes by using magnetic beads coated with streptavidin, and a specific target genome area is enriched before secondary high-throughput sequencing. The capture probe of the target gene has a wide coverage and great sequencing depth, giving a great increase in the study efficiency of the target area in the genome and a significant reduction in the sequencing cost. The target gene capture kit is simple in composition, widely applicable, low in cost and applicable to vast laboratories and scientific and search work.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a target gene capture probe, a capture kit including the target gene capture probe and a method for capturing the target gene. Background technique [0002] Acquiring the genetic information of organisms quickly and accurately has always been of great significance to life science research. For each organism, the genome contains the genetic information of the entire organism. Sequencing technology can truly reflect the genetic information on genomic DNA, and then more comprehensively reveal the complexity and diversity of the genome, so it plays a very important role in life science research. [0003] Sequencing technology can be traced back to the 1950s. As early as 1954, there were reports on early sequencing technology, that is, Whitfeld et al. used chemical degradation methods to determine polyribonucleotide sequences. In 1977, the dideoxynucleotide terminal terminat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 周婕陈亚宁郦征宇
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com