Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for transforming rice into fragrant rice rapidly

A transformation method, rice technology, applied in the field of plant genetic engineering, can solve problems such as unfavorable genes

Inactive Publication Date: 2016-05-04
NINGXIA ACADEMY OF AGRI & FORESTRY SCI
View PDF3 Cites 52 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Conventional breeding of fragrant rice is through hybridization or backcross breeding with fragrant rice. The cycle is long and unfavorable genes are brought in. Using CRISPR / Cas9 technology, the target site of the Badh2 gene is selected, and the gRNA target plasmid is constructed and introduced into the Edit the target site in the genome of the target rice, silence the Badh2 gene, and accumulate 2AP to make the rice produce aroma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for transforming rice into fragrant rice rapidly
  • Method for transforming rice into fragrant rice rapidly
  • Method for transforming rice into fragrant rice rapidly

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0043] 1. The betaine aldehyde dehydrogenase gene Badh2 was selected for the test. The loss of its function will lead to the increase of 2AP precursor substances, thereby accumulating 2AP and making rice produce aroma. Its gene sequence: GenBank: EU770319.1 (see SEQ ID NO: 1)

[0044] 2. Target design

[0045] Any NGG site in the Badh2 gene sequence can be used as a target to design a gRNA target for gene knockout: the gray background is the PAM sequence.

[0046] first exon selection

[0047] gRNA target site position 1: GCCACGGCGATCCCGCAGCGG

[0048] gRNA target site position 2: GCGGCAGCTCTTCGTCGCCGG

[0049] exon 2 selection

[0050] gRNA target site position 3: ACGTGGACGCGGCGGTGGCGG

[0051] gRNA target site position 4: TGGACGCGGCGGTGGCGGCGG

[0052] gRNA target site position 5: GCGCGGGAGGCGCTGAAGAGG

[0053] gRNA target site position 9: AGTACCTCCGCGCAATCGCGG

[0054] gRNA target site position 10: TCCGCGCAATCGCGGCCAAGG

[0055] Exon 7 selection

[0056] gRNA targ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for transforming rice into fragrant rice rapidly. By means of the CRISPR / Case technology and related gene sequences in the rice fragrance metabolic process, a carrier is designed at the specific site, the element is transferred to non-fragrant rice through agrobacterium-mediated transformation, the gene is made to cause deletion mutation at the position of a fixed point, the gene is silent, fragrance cannot be normally metabolized and greatly accumulated, common rice is transformed into fragrant rice, then genetic transformation gene segments are separated from edited genes through selfing or hybridization, and the fragrant rice with the isozygoty capable of being stably inherited is rapidly obtained.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. It specifically relates to a method for cultivating fragrant rice plants through genetic engineering technology. Background technique [0002] Rice is one of the most important food crops in the world, and most of the world's population uses rice as a staple food. With the improvement of people's living standards and the continuous enhancement of health awareness, functional rice with rich nutrition and good quality is more and more favored by people. [0003] Fragrant rice is named for its aroma, and the aroma of fragrant rice can exist in the stems, leaves, flowers, and rice of rice plants except the roots. Basmati rice not only overflows with a fragrant aroma after cooking, but also has excellent nutritional quality and is rich in various amino acids and proteins. The price of high-quality fragrant rice in the international market is 2 to 3 times that of ordinary rice. Important pos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/11C12N15/82C12N15/53A01H5/00
CPCC12N15/1137C12N9/0008C12N15/11C12N15/8205C12N15/8218C12N15/8243C12N2310/10C12Y102/01008
Inventor 王坚
Owner NINGXIA ACADEMY OF AGRI & FORESTRY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com