Method for transforming rice into fragrant rice rapidly
A transformation method, rice technology, applied in the field of plant genetic engineering, can solve problems such as unfavorable genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0043] 1. The betaine aldehyde dehydrogenase gene Badh2 was selected for the test. The loss of its function will lead to the increase of 2AP precursor substances, thereby accumulating 2AP and making rice produce aroma. Its gene sequence: GenBank: EU770319.1 (see SEQ ID NO: 1)
[0044] 2. Target design
[0045] Any NGG site in the Badh2 gene sequence can be used as a target to design a gRNA target for gene knockout: the gray background is the PAM sequence.
[0046] first exon selection
[0047] gRNA target site position 1: GCCACGGCGATCCCGCAGCGG
[0048] gRNA target site position 2: GCGGCAGCTCTTCGTCGCCGG
[0049] exon 2 selection
[0050] gRNA target site position 3: ACGTGGACGCGGCGGTGGCGG
[0051] gRNA target site position 4: TGGACGCGGCGGTGGCGGCGG
[0052] gRNA target site position 5: GCGCGGGAGGCGCTGAAGAGG
[0053] gRNA target site position 9: AGTACCTCCGCGCAATCGCGG
[0054] gRNA target site position 10: TCCGCGCAATCGCGGCCAAGG
[0055] Exon 7 selection
[0056] gRNA targ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 