A special primer and its identification method for identification of excellent clones of Populus nigra
A clonal, black poplar technology, applied in biochemical equipment and methods, bioinformatics, microbial determination/inspection, etc., can solve problems such as allele length polymorphism between individuals, and achieve reliable and reliable detection results. The effect of good practicability, good economic benefits and social benefits
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] The primer composition used to identify the excellent tree of Populus nigra is the 6 pairs of primers in Table 1.
[0030] Table 1 Details of primer sequences
[0031] name
Upstream primer (5'-3')
Downstream primer (5'-3')
NJFUP-poly01
GACACCGTTTCTTTTCTGAG
ACCAGATTCTTCATCTTCCAA
NJFUP-poly02
TCGAATAGCTGGGATACTTC
TATCACCCGAACAAAAACTC
NJFUP-poly05
CCTTAGCCTTTCCACACAAC
GGTCTCCATTTTAGCTGTCA
NJFUP-poly06
GCCCAAACTCTTTATTTGATG
TGGTGGAGGCTAGGATAGTA
NJFUP-poly07
ATTGCTCTTGCAGAAATCAT
GGATACCAAGTCATCGGTAG
NJFUP-poly10
AGAACTTGTGAGGCAGGTAA
AAAGCTCTCCCCTAACAAAG
[0032] The primer is developed based on a large number of microsatellite sequences obtained from the whole poplar genome sequence. The primers are designed in batches using the Misa&Primer 3.0 program. The length of the primers is generally 16-22bp, the GC content is between 40%-60%, and the theoretical annealing t...
Embodiment 2
[0037] The 6 pairs of primers screened in Example 1 were used to detect the genotypes of 43 excellent clones of Populus americana introduced from the United States. The specific method is as follows:
[0038] DNA was extracted from the leaves of Populus nigra according to the method of Murry and Thomson (1990). Then, using this as a template, PCR amplification was carried out on an ABI-9700 thermal cycler using the 6 pairs of primers screened. The total reaction system of PCR is 15uL, and the reaction system includes: template DNA 30ng, 0.27mM dU TPs, 1.5μg BSA, 10pmol of upstream and downstream primers, 2UTaq DNA polymerase, 3uL containing 20mM MgCl 2 Add sterilized deionized water to supplement the reaction volume to 15uL; PCR reaction conditions: 95°C pre-denaturation for 3 minutes; 9 TouchDown cycles: 95°C denaturation for 30s, 59°C to 50°C (the annealing temperature decreases for each cycle 1°C) annealing for 30s, 72°C extension for 30s; then 25 routine PCR cycles: 95°C...
Embodiment 3
[0049] Using the primers screened in Example 1, two (N1, N2) samples that were uncertain whether they were Eutree C100-3 were identified. The standard C100-3 sample was used as the control during the identification process. This example is based on the principle of selecting primers with low genotype frequency. On the premise of meeting the identification requirements, select the fewest primers to easily and effectively obtain accurate information of the sample. The amplification reaction system and amplification conditions are the same as in Example 2.
[0050] Firstly, the DNA of the samples N1 and N2 of Populus americana to be identified and the DNA of the standard control sample C100-3 are used as templates, and the primer NJFUP-poly02 is selected according to the data in Table 4 to perform PCR amplification on 3 samples. After the amplification, Two genotypes of the two samples to be tested were amplified by primer NJFUP-poly02, and compared with the genotypes of the stan...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap