Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A special primer and its identification method for identification of excellent clones of Populus nigra

A clonal, black poplar technology, applied in biochemical equipment and methods, bioinformatics, microbial determination/inspection, etc., can solve problems such as allele length polymorphism between individuals, and achieve reliable and reliable detection results. The effect of good practicability, good economic benefits and social benefits

Active Publication Date: 2018-09-25
NANJING FORESTRY UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] There are differences in the number of SSR repeats at the same site among different individuals of P. americana, resulting in the length polymorphism of allelic sites among individuals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A special primer and its identification method for identification of excellent clones of Populus nigra
  • A special primer and its identification method for identification of excellent clones of Populus nigra
  • A special primer and its identification method for identification of excellent clones of Populus nigra

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The primer composition used to identify the excellent tree of Populus nigra is the 6 pairs of primers in Table 1.

[0030] Table 1 Details of primer sequences

[0031] name

Upstream primer (5'-3')

Downstream primer (5'-3')

NJFUP-poly01

GACACCGTTTCTTTTCTGAG

ACCAGATTCTTCATCTTCCAA

NJFUP-poly02

TCGAATAGCTGGGATACTTC

TATCACCCGAACAAAAACTC

NJFUP-poly05

CCTTAGCCTTTCCACACAAC

GGTCTCCATTTTAGCTGTCA

NJFUP-poly06

GCCCAAACTCTTTATTTGATG

TGGTGGAGGCTAGGATAGTA

NJFUP-poly07

ATTGCTCTTGCAGAAATCAT

GGATACCAAGTCATCGGTAG

NJFUP-poly10

AGAACTTGTGAGGCAGGTAA

AAAGCTCTCCCCTAACAAAG

[0032] The primer is developed based on a large number of microsatellite sequences obtained from the whole poplar genome sequence. The primers are designed in batches using the Misa&Primer 3.0 program. The length of the primers is generally 16-22bp, the GC content is between 40%-60%, and the theoretical annealing t...

Embodiment 2

[0037] The 6 pairs of primers screened in Example 1 were used to detect the genotypes of 43 excellent clones of Populus americana introduced from the United States. The specific method is as follows:

[0038] DNA was extracted from the leaves of Populus nigra according to the method of Murry and Thomson (1990). Then, using this as a template, PCR amplification was carried out on an ABI-9700 thermal cycler using the 6 pairs of primers screened. The total reaction system of PCR is 15uL, and the reaction system includes: template DNA 30ng, 0.27mM dU TPs, 1.5μg BSA, 10pmol of upstream and downstream primers, 2UTaq DNA polymerase, 3uL containing 20mM MgCl 2 Add sterilized deionized water to supplement the reaction volume to 15uL; PCR reaction conditions: 95°C pre-denaturation for 3 minutes; 9 TouchDown cycles: 95°C denaturation for 30s, 59°C to 50°C (the annealing temperature decreases for each cycle 1°C) annealing for 30s, 72°C extension for 30s; then 25 routine PCR cycles: 95°C...

Embodiment 3

[0049] Using the primers screened in Example 1, two (N1, N2) samples that were uncertain whether they were Eutree C100-3 were identified. The standard C100-3 sample was used as the control during the identification process. This example is based on the principle of selecting primers with low genotype frequency. On the premise of meeting the identification requirements, select the fewest primers to easily and effectively obtain accurate information of the sample. The amplification reaction system and amplification conditions are the same as in Example 2.

[0050] Firstly, the DNA of the samples N1 and N2 of Populus americana to be identified and the DNA of the standard control sample C100-3 are used as templates, and the primer NJFUP-poly02 is selected according to the data in Table 4 to perform PCR amplification on 3 samples. After the amplification, Two genotypes of the two samples to be tested were amplified by primer NJFUP-poly02, and compared with the genotypes of the stan...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a dedicated primer used for identifying superior clones of Populus deltoides Marsh. and an identification method for the superior clone of Populus deltoides Marsh. In the method, six pairs of SSR (Simple Sequence Repeat) efficient identification primers are developed aiming at 43 clones obtained through fine breeding. The invention has the outstanding advantages that genetic identification is performed on the 43 clones by utilizing the six pairs of dedicated microsatellite primers for Populus deltoides Marsh.; the identification method is simple and rapid to operate, and high in identification accuracy, and a reliable technological means is provided for identifying superior trees of Populus deltoides Marsh.; an important supervision and inspection method is provided for use of the superior clones of Populus deltoides Marsh.; the application prospect is broad; practicability is very high, and favorable economic benefits and social benefits can be generated.

Description

technical field [0001] The invention relates to a genetic identification method for an excellent clone of Populus nigra, in particular to a special primer for identifying an excellent clone of Populus niger and an identification method thereof. Background technique [0002] American black poplar (Populus deltoides Marsh.) is a species of poplar (Aigeiros) belonging to the genus Populus L. in the family Salicacae. Deciduous tree with tall tree shape, straight and round trunk shape, small taper, medium branch thickness, large, heart-shaped leaves, bright green leaf color, high ornamental value; American black poplar wood material is white, soft, easy to It can be widely used in packaging materials, rotary cutting materials and fiber materials, and plays an important role in solving the problems of plywood, pulp wood, firewood and ecological afforestation. In addition, American black poplar also has the following advantages: ①fast growth and high yield; ②drought resistance, co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11
CPCC12Q1/6895C12Q2600/13G16B20/00
Inventor 李淑娴刘海琳李小平尹佟明
Owner NANJING FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com