Transgenic maize BT176 nucleic acid standard sample and preparation method thereof
A technology of genetically modified corn and standard samples, applied in the biological field, can solve the problems of long turnaround time, high price and many procedures, and achieve the effect of sample stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0047]A transgenic corn BT176 nucleic acid standard sample, comprising a transgenic corn BT176 strain-specific gene fragment and a corn endogenous zein gene fragment, the specific sequence is:
[0048] Specific gene fragment sequence of transgenic maize BT176 line:
[0049] ggccgtgaacgagctgttnnnnnnnnagcaaccagatcggccgacaccnnnnnnnnnnntta
[0050] gaaaacatgtaggcttcttccc;
[0051] Maize endogenous zein gene fragment sequence:
[0052] cgtcgtttcccatctcttcctccnnnnnnnnnnnnnnnnnnnnnaatcagggctcattttc
[0053] tcgctcctcannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngactg
[0054] agggtctcggagtgg.
[0055] A preparation method of the transgenic corn BT176 nucleic acid standard sample, comprising the following steps:
[0056] Step 1: Total DNA Extraction:
[0057] The seeds of the transgenic corn BT176 strain were planted, and the transgenic corn was collected as raw material after the corn matured, and the DNA extraction kit (product number D9093) of TaKaRa Company was used for D...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com