Transgenic maize BT176 nucleic acid standard sample and preparation method thereof

A technology of genetically modified corn and standard samples, applied in the biological field, can solve the problems of long turnaround time, high price and many procedures, and achieve the effect of sample stability

Inactive Publication Date: 2016-06-22
曹际娟 +3
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The more serious problem is that there are only a few varieties of standard materials such as genetically modified soybean flour and genetically modified corn flour MON810 in foreign countries. The price is very expensive, the procedures are complicated, and the turnaround time is long, which cannot meet the needs of inspection and quarantine work in a timely manner.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transgenic maize BT176 nucleic acid standard sample and preparation method thereof
  • Transgenic maize BT176 nucleic acid standard sample and preparation method thereof
  • Transgenic maize BT176 nucleic acid standard sample and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0047]A transgenic corn BT176 nucleic acid standard sample, comprising a transgenic corn BT176 strain-specific gene fragment and a corn endogenous zein gene fragment, the specific sequence is:

[0048] Specific gene fragment sequence of transgenic maize BT176 line:

[0049] ggccgtgaacgagctgttnnnnnnnnagcaaccagatcggccgacaccnnnnnnnnnnntta

[0050] gaaaacatgtaggcttcttccc;

[0051] Maize endogenous zein gene fragment sequence:

[0052] cgtcgtttcccatctcttcctccnnnnnnnnnnnnnnnnnnnnnaatcagggctcattttc

[0053] tcgctcctcannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngactg

[0054] agggtctcggagtgg.

[0055] A preparation method of the transgenic corn BT176 nucleic acid standard sample, comprising the following steps:

[0056] Step 1: Total DNA Extraction:

[0057] The seeds of the transgenic corn BT176 strain were planted, and the transgenic corn was collected as raw material after the corn matured, and the DNA extraction kit (product number D9093) of TaKaRa Company was used for D...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of biotechnology, in particular to a standard sample of transgenic corn BT176 nucleic acid and a preparation method thereof. Take the mature transgenic corn BT176 strain as raw material, extract the total DNA, perform specific PCR amplification and sequencing, and prepare the plasmid. The transgenic corn BT176 nucleic acid standard sample contains the specific gene of the transgenic corn BT176 strain and the endogenous zein Gene. The nucleic acid standard sample prepared by the method of the present invention no longer has biological activity. In the process of construction, amplification and analysis and identification, the laboratory environment is monitored and analyzed, and there is no problem of biological contamination and infection, and the positive control of molecular biology is solved. The source is problematic, and the sample is stable and free of pollution. The preparation of the standard sample of the present invention is completed, which is helpful for comprehensive and in-depth research on the preparation technology and stability assurance technology of the molecular DNA standard sample for the detection of genetically modified components, and actively develops the development of the standard sample for the detection of genetically modified products in my country to fill the gap in the measurement field. has important practical significance.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a standard sample of transgenic corn BT176 nucleic acid and a preparation method thereof. Background technique [0002] GM corn BT176 is a product of Monsanto. The trait changed in this line is herbicide tolerance (glyphosate). It was approved for consumption in different countries: the United States in 1994; Canada, Argentina, Japan, the Netherlands, Switzerland in 1996; Uruguay in 1997; Brazil and Mexico in 1998; Russia in 1999; South Korea and Romania in 2000; South Africa in 2001 . For human consumption or animal feed. [0003] In recent years, breakthroughs have been made in the breeding technology of genetically modified crops, and a number of new varieties have been introduced successively, which have played a huge role in improving crop quality and increasing yield. However, there are many debates about the safety of genetically modified foods. The ecological risks of ge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/63C12N15/10
CPCC12Q1/6895C12Q2600/166
Inventor 曹际娟郑秋月刘冉于珂
Owner 曹际娟
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products