Method and primer as well as kit for detecting mutation sites of promoters C250T and C228T of TERT (Telomerase Reverse Transcriptase) gene

A mutation site, TERT-R technology, applied in the field of life sciences and biology, can solve the problems of low abundance and singleness of non-specific amplification products, achieve low cost, simple operation, and improve the effect of amplification specificity

Inactive Publication Date: 2016-06-22
南京艾迪康医学检验所有限公司
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Touch-down PCR amplification can ensure that the combination of the forward and reverse amplification primers and the sample DNA template occurs between the most complementary sequences. When the annealing temperature is reduced to the level where non-specific amplification occurs, specific amplification products At this time, there is already a geometric number of initial advanta

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and primer as well as kit for detecting mutation sites of promoters C250T and C228T of TERT (Telomerase Reverse Transcriptase) gene
  • Method and primer as well as kit for detecting mutation sites of promoters C250T and C228T of TERT (Telomerase Reverse Transcriptase) gene
  • Method and primer as well as kit for detecting mutation sites of promoters C250T and C228T of TERT (Telomerase Reverse Transcriptase) gene

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0040] Example 1

[0041] The primers for detecting the mutation sites of C228T and C250T of TERT gene promoter include: forward and reverse primers for amplifying the mutation sites of C228T and C250T of TERT gene promoter; its base sequence is:

[0042] TERT-F: AAGGAAGGGGGAGGGGCTGGG

[0043] TERT-R: CGACCCTCTCCGCTGGGGC.

[0044] Preferably, the primers also include a pair of sequencing primers, the base sequence of which is

[0045] TERT-S-F: AAGGAAGGGGGAGGGGCTGGG

[0046] TERT-S-R: CGACCCTCTCCGCTGGGGC.

[0047] In the detection, first use the above-mentioned forward and reverse primers to amplify the mutation sites of TERT gene promoter C228T and C250T to obtain the amplified products, and then use the above-mentioned pair of sequencing primers to sequence the amplified products to obtain the amplified products The base sequence of.

[0048] The kit for detecting the mutation sites of TERT gene promoter C228T and C250T, including: sample DNA extraction reagent (for example, use Tiangen...

Example Embodiment

[0061] Example 2

[0062] Detection process:

[0063] (1) Use blood DNA extraction kit (Tiangen Bio) to extract genomic DNA in blood samples:

[0064] 1) Draw 500μl of blood and add 1000μl of red blood cell lysate, mix by inversion, and leave it at room temperature for 5 minutes, and then mix by inversion several times. Centrifuge at 3000 rpm for 5 min, aspirate the supernatant, leave the white blood cell pellet, add 200 μl of buffer GA, and shake until thoroughly mixed.

[0065] 2) Add 20μl proteinase K solution and mix well.

[0066] 3) Add 200μl of buffer GB, fully invert and mix well, place at 70°C for 10 minutes, the solution should be clear, and centrifuge briefly to remove the water droplets on the inner wall of the cap.

[0067] 4) Add 200μl of absolute ethanol, shake and mix well for 15 seconds. At this time, flocculent precipitation may appear. Centrifuge briefly to remove the water droplets on the inner wall of the cap.

[0068] 5) Put the solution and flocculent precipitate o...

Example Embodiment

[0094] Example 3

[0095] The nucleic acid detection kit of the present invention is used to detect clinical samples.

[0096] Twenty anticoagulated blood samples from patients with glioma were taken and submitted for testing, and the genomic DNA in the samples was extracted according to the detection process described in Example 2, and reagents were prepared and tested.

[0097] Add 2 μl of each sample genomic DNA solution extracted according to the detection procedure described in Example 2 into the PCR reaction solution of the detection system. Do positive, negative and blank controls at the same time. Use an ordinary PCR machine for detection, and the time is 160 minutes.

[0098] The results of electrophoresis are as figure 1 It shows that the forward and reverse primers TERT-F and TERT-R used in the present invention can effectively amplify blood samples with a single band.

[0099] The TERT gene promoter C228T forward sequencing result of sample 1 is as follows figure 2 As sho...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method, a primer and a kit for detecting mutation sites of promoters C228T and C250T of a telomerase reverse transcriptase (TERT) gene. The primer comprises a forward primer and a reverse primer for amplifying the mutation sites of the promoters C228T and C250T of the TERT gene, and in addition, can also comprise one pair of sequencing primers. A Touch-down PCR (Polymerase Chain Reaction) amplification technique is combined with a Sanger sequencing method; the occurrence conditions of the mutation sites of the promoters C228T and C250T of the TERT gene in a body of a patient suffered from a brain glioma can be quickly detected.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and particularly relates to primers, methods and kits for detecting C250T and C228T mutation sites of TERT gene promoters. Background technique [0002] Glioma is the most common primary malignant tumor in the nervous system. The clinical and basic researches that have been carried out have proved that the prognosis of glioma is extremely poor. The biological characteristics of malignant tumors such as uncontrollable tumor cell proliferation, slowed tumor cell apoptosis, tumor cell invasiveness, and new blood vessel growth make the brain The treatment of glioma faces enormous difficulties. Human telomerase is one of the tumor markers, and the activation of telomerase plays an important role in the occurrence and development of tumors. Telomerase is composed of telomerase RNA, telomerase-associated protein, and telomerase reverse transcriptase (TERT). TERT is considered to be a key...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6869C12Q1/6886C12Q2600/156C12Q2531/113C12Q2535/101
Inventor 单战刘赵玲王淑一
Owner 南京艾迪康医学检验所有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap