Method and primer as well as kit for detecting mutation sites of promoters C250T and C228T of TERT (Telomerase Reverse Transcriptase) gene
A mutation site, TERT-R technology, applied in the field of life sciences and biology, can solve the problems of low abundance and singleness of non-specific amplification products, achieve low cost, simple operation, and improve the effect of amplification specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Primers for detecting TERT gene promoter C228T, C250T mutation sites, including: forward and reverse primers for amplifying TERT gene promoter C228T, C250T mutation sites; its base sequence is:
[0042] TERT-F: AAGGAAGGGGAGGGGCTGGG
[0043] TERT-R: CGACCTCTCTCCGCTGGGGC.
[0044] Preferably, the primers also include a pair of sequencing primers, the base sequence of which is
[0045] TERT-S-F: AAGGAAGGGGAGGGGCTGGG
[0046] TERT-S-R: CGACCTCTCTCCGCTGGGGC.
[0047]In the detection, first use the above-mentioned forward and reverse primers to amplify the C228T and C250T mutation sites of the TERT gene promoter to obtain the amplified products, and then use the above-mentioned pair of sequencing primers to sequence the amplified products to obtain the amplified products base sequence.
[0048] The kit for detecting the C228T and C250T mutation sites of the TERT gene promoter, including: sample DNA extraction reagents (for example, use Tiangen Biotech’s kit to extract sam...
Embodiment 2
[0062] Detection process:
[0063] (1) Use the blood DNA extraction kit (Tiangen Biology) to extract the genomic DNA in the blood sample:
[0064] 1) Take 500 μl of blood and add 1000 μl of erythrocyte lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed.
[0065] 2) Add 20 μl proteinase K solution and mix well.
[0066] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0067] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0068] 5) Put the solution and flocc...
Embodiment 3
[0095] The nucleic acid detection kit of the present invention is used to detect clinical samples.
[0096] 20 samples of anticoagulated blood samples from patients with glioma were taken for inspection, and the genomic DNA in the samples was extracted according to the detection process described in Example 2, and reagents were prepared and tested.
[0097] Add 2 μl of the genomic DNA solution of each sample extracted according to the detection process described in Example 2 into the PCR reaction solution of the detection system. Do positive, negative and blank controls at the same time. Detect with common PCR instrument, the time is 160 minutes.
[0098] Electrophoresis results such as figure 1 As shown, it shows that the forward and reverse primers TERT-F and TERT-R used in the present invention can effectively amplify the blood sample, and the band is single.
[0099] The results of forward sequencing of the TERT gene promoter C228T of sample 1 are as follows: figure 2...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
